쥐 IL15/IL-15/Interleukin 15 Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
 IL15 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_008357.1
cDNA 크기:489bp
cDNA 설명:Full length Clone DNA of Mus musculus interleukin 15 with N terminal HA tag.
유전자 동의어:AI503618, Il15
:Mouse
벡터:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-mIL15
제한 사이트:KpnI + XbaI (6kb + 0.49kb)
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL15 qPCR primers for gene expression analysis, MP200121 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
 IL15 Gene Plasmid Map
Mouse IL15 ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

The protein encoded by IL15 gene is a cytokine that regulates T and natural killer cell activation and proliferation. This cytokine and interleukine 2 share many biological activities. They are found to bind common hematopoietin receptor subunits, and may compete for the same receptor, and thus negatively regulate each other's activity. The number of CD8+ memory cells is shown to be controlled by a balance between this cytokine and IL2. This cytokine induces the activation of JAK kinases, as well as the phosphorylation and activation of transcription activators STAT3, STAT5, and STAT6. Studies of the mouse counterpart suggested that this cytokine may increase the expression of apoptosis inhibitor BCL2L1/BCL-x(L), possibly through the transcription activation activity of STAT6, and thus prevent apoptosis. Alternatively spliced transcript variants of this gene have been reported.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

참고자료
  • Mongini PKA, Gupta R, Boyle E, et al. TLR-9 and IL-15 synergy promotes the in vitro clonal expansion of chronic lymphocytic leukemia B cells. Journal of immunology (Baltimore, Md : 1950). 2015;195(3):901-923.
  • Size / Price
    Cat No: MG50091-NY
    정가: 
    가격:      (You Save: )
    Contact Us
    이미지
    • Mouse IL15 ORF mammalian expression plasmid, N-HA tag
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".