쥐 IL-23/IL-23A Gene ORF cDNA clone expression plasmid, C-His 태그

    데이터시트리뷰관련제품프로토콜
     IL23A cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_031252.2
    cDNA 크기:591bp
    cDNA 설명:Full length Clone DNA of Mus musculus interleukin 23, alpha subunit p19 with C terminal His tag.
    유전자 동의어:p19, IL-23
    :Mouse
    벡터:pCMV3-C-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL23A qPCR primers for gene expression analysis, MP201044 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    연구배경

    IL-23, which is mainly secreted by antigen-presenting cells, is a member of the IL-12 family, which includes IL-12, IL-27, and IL-35[10]. IL-23 is a heterodimeric cytokine, comprised a unique p19 subunit and p40 subunit, the latter of which is shared with IL-12. The receptor for IL-23 consists of IL-23R and IL-12Rβ1, the latter of which is also characteristic of IL-12. IL-23 is essential for Th17 differentiation, expansion, and survival by binding to its receptor, thereby activating the signaling pathway [11,12]. Many studies revealed that the IL-23/Th17 pathway is implicated in the pathophysiology of various autoimmune diseases, such as autoimmune arthritis[13], primary biliary cirrhosis[14], and inflammatory bowel disease[15].

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    참고자료
  • Ye X, Zhang L, Wang H, et al. The Role of IL-23/Th17 Pathway in Patients with Primary Immune Thrombocytopenia. Kuwana M, ed. PLoS ONE. 2015;10(1):e0117704.
  • Size / Price
    Cat No: MG51086-CH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".