After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 IL6R/IL-6R/CD126 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Mouse IL6R cDNA 클론 제품 정보
Gene_bank_ref_id:NM_010559.2
cDNA 크기:1383bp
cDNA 설명:Full length Clone DNA of Mus musculus interleukin 6 receptor, alpha.
유전자 동의어:Apn, Cd13, Lap-1, Lap1, p150
:Mouse
벡터:pCMV3-untagged
Plasmid:pCMV3-mIL6RA
제한 사이트:KpnI + XbaI (6.1kb + 1.38kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 486 T>C and 903 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL6R Gene Plasmid Map
Mouse IL6R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
연구배경

Interleukin 6 receptor (IL-6R) also known as CD126 (Cluster of Differentiation 126) is a type I cytokine receptor. The low concentration of a soluble form of IL-6 receptor (sIL-6R) acts as an agonist of IL-6 activity. In the IL-6R/CD126/IL6R system, both a membrane-bound IL-6R and a sIL-6R protein are able to mediate IL-6 signals into the cells through the interaction of gp130. The resulting IL-6/sIL-6R protein complex is also capable of binding to gp130 and inducing intracellular signalling. Through this so-called 'trans-signalling' mechanism, IL-6 is able to stimulate cells that lack an endogenous mIL-6R. High levels of IL-6 and sIL-6R have been reported in several chronic inflammatory and autoimmune diseases as well as in cancer.

참고자료
  • Barill S, et al. (2000) The role of interleukin-6 and interleukin-6/interleukin-6 receptor-alpha complex in the pathogenesis of multiple myeloma. Eur Cytokine Netw. 11(4): 546-51.
  • Kang KW, et al. (2007) Novel role of IL-6/SIL-6R signaling in the expression of inducible nitric oxide synthase (iNOS) in murine B16, metastatic melanoma clone F10.9, cells. Free Radic Biol Med. 42(2): 215-27.
  • Size / Price
    Cat No: MG50280-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Mouse IL6R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".