쥐 CD18/Integrin beta 2/ITGB2 Gene ORF cDNA clone expression plasmid, C-Myc 태그

데이터시트리뷰관련제품프로토콜
 ITGB2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_008404.4
cDNA 크기:2313bp
cDNA 설명:Full length Clone DNA of Mus musculus integrin beta 2 with C terminal Myc tag.
유전자 동의어:2E6, LAD, Cd18, Lfa1, MF17, LCAMB, AI528527, Itgb2
:Mouse
벡터:pCMV3-C-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ITGB2 qPCR primers for gene expression analysis, MP200380 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Integrins form a family of heterodimeric transmembrane receptors that regulate cell–adhesion and cell-extracellular matrix interactions. Lymphocyte function-associated antigen 1 (LFA-1, αLβ2) is a leukocyte specific integrin that mediates firm arrest of leukocytes on the endothelium during migration and establishes cell-cell contacts such as the immunological synapse between DCs and T cells. At the molecular level, transient modifications of adhesion are accomplished by conformational changes of LFA-1 from a bent down inactive to an upright active conformation with an open headpiece, leading to low- and high-affinity for its major ligand ICAM-1 respectively.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

참고자료
  • Eich C, Lasonder E, Cruz LJ, et al. Proteome Based Construction of the Lymphocyte Function-Associated Antigen 1 (LFA-1) Interactome in Human Dendritic Cells. Mattei F, ed. PLoS ONE. 2016;11(2):e0149637.
  • Size / Price
    Cat No: MG50359-CM
    정가: 
    가격:      (You Save: )
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".