After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 KIRREL1/NEPH1 Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Mouse KIRREL cDNA 클론 제품 정보
Gene_bank_ref_id:NM_130867.2
cDNA 크기:2370bp
cDNA 설명:Full length Clone DNA of Mus musculus kin of IRRE like (Drosophila) with N terminal Myc tag.
유전자 동의어:Neph1, Kirrel1, Kirrel
:Mouse
벡터:pCMV3-SP-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

NEPH1 (KIRREL1) belongs to a family of three closely related transmembrane proteins of the Ig superfamily with a structure similar to that of nephrin. All three Neph proteins share a conserved podocin-binding motif; mutation of a centrally located tyrosine residue dramatically lowers the affinity of Neph1 for podocin. Neph1 triggers AP-1 activation similarly to nephrin but requires the presence of Tec family kinases for efficient transactivation. Neph1 consists of a signal peptide, five Ig-like C2-type domains with the middle domain overlapping with a PKD-like domain, an RGD sequence, a transmembrane domain and a cytoplasmic tail, which is expressed in slit diaphragm domains of podocytes and in vertebrate and invertebrate nervous systems. Neph1 is abundantly expressed in the kidney, specifically expressed in podocytes of kidney glomeruli, and plays a significant role in the normal development and function of the glomerular permeability. Neph1 interacts with nephrin in vitro and in vivo, and able to stimulate transcriptional activation in a model system, such as the activation the transcription factor AP-1 via the stimulation of a MAPK module. Neph1 is crucial for the integrity of the slit diaphragm, as Neph1 gene knockout mice results in effacement of glomerular podocytes, heavy proteinuria, and early postnatal death.

참고자료
  • Sellin L, et al. (2003) NEPH1 defines a novel family of podocin interacting proteins. FASEB J. 17(1): 115-7.
  • Kim EY, et al. (2009) Neph1 regulates steady-state surface expression of Slo1 Ca(2+)-activated K(+) channels: different effects in embryonic neurons and podocytes. Am J Physiol Cell Physiol. 297(6): C1379-88.
  • Size / Price
    Cat No: MG50193-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".