Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, untagged

Cat: MG50268-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Leukotriene A4 Hydrolase Reagents

CRO Services

Product recommended


All Leukotriene A4 Hydrolase Reagents

Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1836 bp
Description
Full length Clone DNA of Mouse leukotriene A4 hydrolase.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, untagged Alternative Names

Lta4h cDNA ORF Clone, Mouse

Leukotriene A4 Hydrolase Background Information

Leukotriene A-4 hydrolase, also known as LTA-4 hydrolase, Leukotriene A (4) hydrolase, LTA4H and LTA4, is cytoplasm protein which belongs to the peptidase M1 family. LTA4H hydrolyzes an epoxide moiety of leukotriene A4 (LTA-4) to form leukotriene B4 (LTB-4). This enzyme also has some peptidase activity. The leukotrienes (LTs) are a class of structurally related lipid mediators involved in the development and maintenance of inflammatory and allergic reactions. In the biosynthesis of LTs, arachidonic acid was converted into the unstable intermediate epoxide LTA4, which may in turn be conjugated with glutathione to form the spasmogenic LTC4, or hydrolyzed into the proinflammatory lipid mediator LTB4 in a reaction catalyzed by Leukotriene A4 hydrolase (LTA4H). LTB4 is a classical chemoattractant of human neutrophils and triggers adherence and aggregation of leukocytes to vascular endothelium, and also modulates immune responses. As a bifunctional zinc metalloenzyme, LTA4H also exhibits an anion-dependant arginyl aminopeptidase activity of high efficiency and specificity in addition to its epoxide hydrolase activity. LTA4H is regarded as a therapeutic target for inflammation.

Full Name
leukotriene A4 hydrolase
References
  • Mancini, JA. et al.,1995, Eur. J. Biochem. 231: 65-71.
  • Orning, L. et al., 1994, J. Biol. Chem. 269: 11269-73.
  • Rudberg, PC. et al., 2004, J. Biol. Chem. 279: 27376-82.
  • Qiu, H. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 8161-6.
  • Leukotriene A4 Hydrolase cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Leukotriene A4 Hydrolase cDNA ORF Clone in Cloning Vector, Rat RG83397-U
    Leukotriene A4 Hydrolase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83397-ACGLN

    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Leukotriene A4 Hydrolase cDNA ORF Clone in Cloning Vector, Mouse MG50268-M
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50268-ACG
    Leukotriene A4 Hydrolase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50268-ACGLN
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50268-ANG
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50268-ACR
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50268-ANR
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50268-CF
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50268-NF
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, C-His tag MG50268-CH
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, N-His tag MG50268-NH
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, C-HA tag MG50268-CY
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, N-HA tag MG50268-NY
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, C-Myc tag MG50268-CM
    Leukotriene A4 Hydrolase cDNA ORF Clone, Mouse, N-Myc tag MG50268-NM
    Leukotriene A4 Hydrolase qPCR Primer Pairs, Mouse MP200293

    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Leukotriene A4 Hydrolase cDNA ORF Clone in Cloning Vector, Human HG10276-G
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, untagged HG10276-UT
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, C-GFPSpark® tag HG10276-ACG
    Leukotriene A4 Hydrolase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10276-ACGLN
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, N-GFPSpark® tag HG10276-ANG
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, C-OFPSpark® tag HG10276-ACR
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, N-OFPSpark® tag HG10276-ANR
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10276-CF
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10276-NF
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, C-His tag HG10276-CH
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, N-His tag HG10276-NH
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, C-HA tag HG10276-CY
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, N-HA tag HG10276-NY
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, C-Myc tag HG10276-CM
    Leukotriene A4 Hydrolase cDNA ORF Clone, Human, N-Myc tag HG10276-NM
    Leukotriene A4 Hydrolase qPCR Primer Pairs, Human HP100323
    info info
    添加购物车成功! 添加购物车失败!