After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 Lactotransferrin/LTF Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Mouse LTF cDNA 클론 제품 정보
Gene_bank_ref_id:NM_008522.3
cDNA 크기:2124bp
cDNA 설명:Full length Clone DNA of Mus musculus lactotransferrin with N terminal His tag.
유전자 동의어:Lf, Csp82, Ms10r, MMS10R, Ltf
:Mouse
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Lactotransferrin, also known as Lactoferrin, Talalactoferrin and LTF, is a secreted protein which belongs to the transferrin family. Transferrins are iron binding transport proteins which can bind two Fe3+ ions in association with the binding of an anion, usually bicarbonate. Lactotransferrin has antimicrobial activity which depends on the extracellular cation concentration. Lactoferroxins A, B and C have opioid antagonist activity. Lactoferroxin A shows preference for mu-receptors, while lactoferroxin B and lactoferroxin C have somewhat higher degrees of preference for kappa-receptors than for mu-receptors. Lactoferrin / LTF is a globular glycoprotein that is widely represented in various secretory fluids, such as milk, saliva, tears, and nasal secretions. Lactoferrin / LTF is also present in secondary granules of PMN and is secreted by some acinar cells. Lactoferrin / LTF can be purified from milk or produced recombinantly. Human colostrum has the highest concentration, followed by human milk, then cow milk. Lactoferrin / LTF is one of the components of the immune system of the body; it has antimicrobial activity (bacteriocide, fungicide) and is part of the innate defense, mainly at mucoses. In particular, lactoferrin provides antibacterial activity to human infants. Lactoferrin interacts with DNA and RNA, polysaccharides and heparin, and shows some of its biological functions in complexes with these ligands.

참고자료
  • Sánchez L, et al.,1992, Arch. Dis. Child. 67 (5): 657 - 61.
  • Wakabayashi H, et al., 2000, J. Antimicrob. Chemother. 46 (4): 595-602.
  • Nozaki A, et al., 2003, J. Biol. Chem. 278 (12): 10162-73.
  • Azzam HS, et al., 2007, Liver Int. 27 (1): 17-25.
  • Size / Price
    Cat No: MG50750-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".