After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 C4.4A/LYPD3 Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Mouse LYPD3 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_133743.1
cDNA 크기:1092bp
cDNA 설명:Full length Clone DNA of Mus musculus Ly6/Plaur domain containing 3 with N terminal HA tag.
유전자 동의어:C4.4a, 2310061G07Rik, Lypd3
:Mouse
벡터:pCMV3-SP-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

Ly6 / PLAUR domain-containing protein 3, also known as GPI-anchored metastasis-associated protein C4.4A homolog, Matrigel-induced gene C4 protein, MIG-C4 and LYPD3, is a cell membrane protein which contains two UPAR/Ly6 domains. Human LYPD3 contains two UPAR/Ly6 domains. LYPD3 is expressed in placenta, skin and urothelium. It is found in suprabasal keratinocytes of chronic wounds. Weak expression of LYPD3 is found in esophagus and peripheral blood mononuclear cells. It is found in the majority of primary and metastatic transitional cell carcinomas (TCCs) and as well in breast cancer tissues, but not in adjacent normal tissues. High expression of LYPD3 is found in the tumor component of some noninvasive superficial lesions and in invasive and metastatic urothelial cancers. LYPD3 is up-regulated in migrating keratinocytes during epithelisation of incisional skin wounds. LYPD3 supports cell migration. It may be involved in urothelial cell-matrix interactions. It may also be involved in tumor progression

참고자료
  • Smith B.A., et al., 2001, Cancer Res. 61:1678-85.
  • Wuerfel J., et al., 2001, Gene 262:35-41.
  • Clark H.F., et al., 2003, Genome Res. 13:2265-70.
  • Fletcher G.C., et al., 2003, Br. J. Cancer 88:579-85.
  • Hansen L.V., et al., 2004, Biochem. Eng. J. 380:845-57.
  • Size / Price
    Cat No: MG50546-NY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".