MAEA cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52755-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MAEA Reagents

CRO Services

Product recommended


All MAEA Reagents

MAEA cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1191 bp
Description
Full length Clone DNA of Mouse macrophage erythroblast attacher with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAEA cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

1110030D19Rik cDNA ORF Clone, Mouse;EMP cDNA ORF Clone, Mouse;Gid9 cDNA ORF Clone, Mouse

MAEA Background Information

Full Name
macrophage erythroblast attacher

MAEA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MAEA cDNA ORF Clone in Cloning Vector, Rat RG8A1577-U
MAEA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1577-ACGLN

MAEA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MAEA cDNA ORF Clone in Cloning Vector, Mouse MG52755-G
MAEA cDNA ORF Clone, Mouse, untagged MG52755-UT
MAEA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52755-ACGLN
MAEA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52755-ACG
MAEA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52755-ANG
MAEA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52755-ACR
MAEA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52755-ANR
MAEA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52755-CF
MAEA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52755-NF
MAEA cDNA ORF Clone, Mouse, C-His tag MG52755-CH
MAEA cDNA ORF Clone, Mouse, N-His tag MG52755-NH
MAEA cDNA ORF Clone, Mouse, C-HA tag MG52755-CY
MAEA cDNA ORF Clone, Mouse, N-HA tag MG52755-NY
MAEA cDNA ORF Clone, Mouse, N-Myc tag MG52755-NM

MAEA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MAEA cDNA ORF Clone in Cloning Vector, Human HG14116-G
MAEA cDNA ORF Clone, Human, untagged HG14116-UT
MAEA cDNA ORF Clone, Human, C-GFPSpark® tag HG14116-ACG
MAEA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14116-ACGLN
MAEA cDNA ORF Clone, Human, N-GFPSpark® tag HG14116-ANG
MAEA cDNA ORF Clone, Human, C-OFPSpark® tag HG14116-ACR
MAEA cDNA ORF Clone, Human, N-OFPSpark® tag HG14116-ANR
MAEA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14116-CF
MAEA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14116-NF
MAEA cDNA ORF Clone, Human, C-His tag HG14116-CH
MAEA cDNA ORF Clone, Human, N-His tag HG14116-NH
MAEA cDNA ORF Clone, Human, C-HA tag HG14116-CY
MAEA cDNA ORF Clone, Human, N-HA tag HG14116-NY
MAEA cDNA ORF Clone, Human, C-Myc tag HG14116-CM
MAEA cDNA ORF Clone, Human, N-Myc tag HG14116-NM
MAEA qPCR Primer Pairs, Human HP102769
info info
添加购物车成功! 添加购物车失败!