Myoglobin cDNA ORF Clone, Mouse, N-His tag

Cat: MG51397-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Myoglobin Reagents

CRO Services

Product recommended


All Myoglobin Reagents

Myoglobin cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
465 bp
Description
Full length Clone DNA of Mouse myoglobin with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Myoglobin cDNA ORF Clone, Mouse, N-His tag Alternative Names

AI325109 cDNA ORF Clone, Mouse

Myoglobin Background Information

Full Name
myoglobin

Myoglobin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Myoglobin cDNA ORF Clone in Cloning Vector, Rat RG82499-U
Myoglobin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82499-ACGLN

Myoglobin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Myoglobin cDNA ORF Clone in Cloning Vector, Mouse MG51397-U
Myoglobin cDNA ORF Clone, Mouse, untagged MG51397-UT
Myoglobin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51397-ACG
Myoglobin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51397-ACGLN
Myoglobin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51397-ACR
Myoglobin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51397-CF
Myoglobin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51397-NF
Myoglobin cDNA ORF Clone, Mouse, C-His tag MG51397-CH
Myoglobin cDNA ORF Clone, Mouse, C-HA tag MG51397-CY
Myoglobin cDNA ORF Clone, Mouse, N-HA tag MG51397-NY
Myoglobin cDNA ORF Clone, Mouse, C-Myc tag MG51397-CM
Myoglobin cDNA ORF Clone, Mouse, N-Myc tag MG51397-NM
Myoglobin qPCR Primer Pairs, Mouse MP201267

Myoglobin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Myoglobin cDNA ORF Clone in Cloning Vector, Human HG18051-U
Myoglobin cDNA ORF Clone, Human, untagged HG18051-UT
Myoglobin cDNA ORF Clone, Human, C-GFPSpark® tag HG18051-ACG
Myoglobin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18051-ACGLN
Myoglobin cDNA ORF Clone, Human, C-OFPSpark® tag HG18051-ACR
Myoglobin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18051-CF
Myoglobin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18051-NF
Myoglobin cDNA ORF Clone, Human, C-His tag HG18051-CH
Myoglobin cDNA ORF Clone, Human, N-His tag HG18051-NH
Myoglobin cDNA ORF Clone, Human, C-HA tag HG18051-CY
Myoglobin cDNA ORF Clone, Human, N-HA tag HG18051-NY
Myoglobin cDNA ORF Clone, Human, C-Myc tag HG18051-CM
Myoglobin cDNA ORF Clone, Human, N-Myc tag HG18051-NM
info info
添加购物车成功! 添加购物车失败!