MBIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51082-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MBIP Reagents
CRO Services
Product recommended

All MBIP Reagents
MBIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1026 bp
Description
Full length Clone DNA of Mouse MAP3K12 binding inhibitory protein 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MBIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
4933408E06Rik cDNA ORF Clone, Mouse
MBIP Background Information
Full Name
MAP3K12 binding inhibitory protein 1

MBIP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MBIP cDNA ORF Clone in Cloning Vector, Mouse MG51082-G
MBIP cDNA ORF Clone, Mouse, untagged MG51082-UT
MBIP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51082-ACGLN
MBIP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51082-ACG
MBIP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51082-ANG
MBIP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51082-ACR
MBIP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51082-ANR
MBIP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51082-CF
MBIP cDNA ORF Clone, Mouse, C-His tag MG51082-CH
MBIP cDNA ORF Clone, Mouse, N-His tag MG51082-NH
MBIP cDNA ORF Clone, Mouse, C-HA tag MG51082-CY
MBIP cDNA ORF Clone, Mouse, N-HA tag MG51082-NY
MBIP cDNA ORF Clone, Mouse, C-Myc tag MG51082-CM
MBIP cDNA ORF Clone, Mouse, N-Myc tag MG51082-NM
MBIP qPCR Primer Pairs, Mouse MP201040

MBIP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MBIP cDNA ORF Clone in Cloning Vector, Human HG10453-M
MBIP cDNA ORF Clone, Human, untagged HG10453-UT
MBIP cDNA ORF Clone, Human, C-GFPSpark® tag HG10453-ACG
MBIP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10453-ACGLN
MBIP cDNA ORF Clone, Human, N-GFPSpark® tag HG10453-ANG
MBIP cDNA ORF Clone, Human, C-OFPSpark® tag HG10453-ACR
MBIP cDNA ORF Clone, Human, N-OFPSpark® tag HG10453-ANR
MBIP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10453-CF
MBIP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10453-NF
MBIP cDNA ORF Clone, Human, C-His tag HG10453-CH
MBIP cDNA ORF Clone, Human, N-His tag HG10453-NH
MBIP cDNA ORF Clone, Human, C-HA tag HG10453-CY
MBIP cDNA ORF Clone, Human, N-HA tag HG10453-NY
MBIP cDNA ORF Clone, Human, C-Myc tag HG10453-CM
MBIP cDNA ORF Clone, Human, N-Myc tag HG10453-NM
MBIP qPCR Primer Pairs, Human HP100482
info info
添加购物车成功! 添加购物车失败!