쥐 MEP1A Gene ORF cDNA clone expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
 MEP1A cDNA 클론 제품 정보
Gene_bank_ref_id:NM_008585.2
cDNA 크기:2283bp
cDNA 설명:Full length Clone DNA of Mus musculus meprin 1 alpha with C terminal HA tag.
유전자 동의어:Mep1, Mep-1, Mep-1a, AI098089, AW107200, Mep1a
:Mouse
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MEP1A qPCR primers for gene expression analysis, MP200057 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

Meprin A subunit alpha, also known as MEP1A, and Endopeptidase-2, is a single-pass type I  membrane protein which belongs to the peptidase M12A family. MEP1A contains one EGF-like domain, one MAM domain, and one MATH domain. Meprins are unique plasma membrane and secreted metalloproteinases that are highly regulated at the transcriptional and post-translational levels. Meprin alpha and beta subunits are abundantly expressed in kidney and intestinal epithelial cells, are secreted into the urinary tract and intestinal lumen, and are found in leukocytes and cancer cells under certain conditions. Meprins are capable of proteolytically degrading extracellular matrix proteins, proteolytically processing bioactive proteins, and play a role in inflammatory processes. Meprin A and B are highly regulated, secreted and cell-surface homo- and hetero-oligomeric enzymes. Meprins are abundantly expressed in kidney and intestine. The multidomain alpha and beta subunits have high sequence identity. They have very different substrate specificities, oligomerization potentials and are differentially regulated. Meprin A appears to be an important therapeutic target and urinary excretion appears to be a potential biomarker of acute kidney injury ( AKI ).

참고자료
  • Bertenshaw,GP. et al., 2002, Biol Chem. 383 (7-8):1175-83.
  • Bond, JS. et al., 2005, FEBS Lett. 579 (15): 3317-22.
  • Herzog, C. et al., 2007, Kidney Int. 71 (10): 1009-18.
  • Yura, RE. et al., 2009, Am J Physiol Renal Physiol. 296 (1): F135-44.
  • Size / Price
    Cat No: MG50057-CY
    정가: 
    가격:      (You Save: )
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".