MESDC2 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50200-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MESDC2 Reagents
CRO Services
Product recommended

All MESDC2 Reagents
MESDC2 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
674 bp
Description
Full length Clone DNA of Mouse mesoderm development candidate 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MESDC2 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2210015O11Rik cDNA ORF Clone, Mouse;AW537813 cDNA ORF Clone, Mouse;mesd cDNA ORF Clone, Mouse;mKIAA0081 cDNA ORF Clone, Mouse;msd cDNA ORF Clone, Mouse
MESDC2 Background Information

LDLR chaperone MESD, also known as Mesoderm development protein, Mesoderm development candidate 2, Renal carcinoma antigen NY-REN-61 and MESDC2, is a member of the MESD family. MESDC2 is a chaperone specifically assisting the folding of beta-propeller/EGF modules within the family of low-density lipoprotein receptors (LDLRs). The LDLR maturation activity resides in the N- and C-terminal unstructured regions. MESDC2 acts as a modulator of the Wnt pathway, since some LDLRs are coreceptors for the canonical Wnt pathway. MESDC2 is essential for specification of embryonic polarity and mesoderm induction.

Full Name
mesoderm development candidate 2
References
  • Scanlan M.J. et al., 1999, Int. J. Cancer 83:456-464.
  • Veltman,IM. et al.,2005, Hum Mol Genet  14 (14):1955-63.
  • Koduri V. et al., 2007, Biochemistry 46:6570-7.
  • MESDC2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    MESDC2 cDNA ORF Clone in Cloning Vector, Rat RG87531-U
    MESDC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87531-ACGLN

    MESDC2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MESDC2 cDNA ORF Clone in Cloning Vector, Mouse MG50200-M
    MESDC2 cDNA ORF Clone, Mouse, untagged MG50200-UT
    MESDC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50200-ACGLN
    MESDC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50200-ACG
    MESDC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50200-ACR
    MESDC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50200-CF
    MESDC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50200-NF
    MESDC2 cDNA ORF Clone, Mouse, C-His tag MG50200-CH
    MESDC2 cDNA ORF Clone, Mouse, N-His tag MG50200-NH
    MESDC2 cDNA ORF Clone, Mouse, C-HA tag MG50200-CY
    MESDC2 cDNA ORF Clone, Mouse, N-HA tag MG50200-NY
    MESDC2 cDNA ORF Clone, Mouse, C-Myc tag MG50200-CM
    MESDC2 qPCR Primer Pairs, Mouse MP200229

    MESDC2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MESDC2 cDNA ORF Clone in Cloning Vector, Human HG10949-M
    MESDC2 cDNA ORF Clone, Human, untagged HG10949-UT
    MESDC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10949-ACG
    MESDC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10949-ACGLN
    MESDC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10949-ACR
    MESDC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10949-CF
    MESDC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10949-NF
    MESDC2 cDNA ORF Clone, Human, C-His tag HG10949-CH
    MESDC2 cDNA ORF Clone, Human, N-His tag HG10949-NH
    MESDC2 cDNA ORF Clone, Human, C-HA tag HG10949-CY
    MESDC2 cDNA ORF Clone, Human, N-HA tag HG10949-NY
    MESDC2 cDNA ORF Clone, Human, C-Myc tag HG10949-CM
    MESDC2 cDNA ORF Clone, Human, N-Myc tag HG10949-NM
    MESDC2 qPCR Primer Pairs, Human HP100826
    info info
    添加购物车成功! 添加购物车失败!