MMP7 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50492-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MMP7 Reagents

CRO Services

Product recommended


All MMP7 Reagents

MMP7 cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
804 bp
Description
Full length Clone DNA of Mouse matrix metallopeptidase 7 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP7 cDNA ORF Clone, Mouse, C-HA tag Alternative Names

MAT cDNA ORF Clone, Mouse

MMP7 Background Information

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological and pathological processes such as morphogenesis, differentiation, angiogenesis, tissue remodeling, and tumor invasion. MMPs are synthesized as pro-enzymes and converted to active form by extracellular proteinases. MMP7, also referred to as matrilysin, is the smallest member of the MMP family and differs from other MMP members in that it lacks the C-terminal hemopexin-like domain. MMP7 is produced primarily by mucosal epithelia, and is capable of degrading various ECM proteins including proteoglycans, fibronectin, elastin and casein. This enzyme serves essential functions in both innate defense and wound healing, and appears to be one of the most important MMPs in human colon cancers. It has been reported that MMP7 contributes to tumor malignancy probably by cleaving cell surface proteins such as Fas ligand, degradation of IgG or inducing E-cadherin-mediated cell aggregation. In addition, matrilysin is also identified as a mediator of pulmonary fibrosis and a potential therapeutic target.

Full Name
matrix metallopeptidase 7
References
  • Muller D., et al.,(1988), The collagenase gene family in humans consists of at least four members. Biochem. J. 253:187-192.
  • Marti H.P., et al., (1992), Molecular characterization of a low-molecular-mass matrix metalloproteinase secreted by glomerular mesangial cells as PUMP-1.Biochem. J. 285:899-905.
  • Gaire M., et al.,(1994), Structure and expression of the human gene for the matrix metalloproteinase matrilysin.J. Biol. Chem. 269:2032-2040.
  • info info
    添加购物车成功! 添加购物车失败!