쥐 MMP-8 / MMP8 Gene ORF cDNA clone expression plasmid, C-HA 태그

    데이터시트리뷰관련제품프로토콜
     MMP8 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_008611.4
    cDNA 크기:1398bp
    cDNA 설명:Full length Clone DNA of Mus musculus matrix metallopeptidase 8 with C terminal HA tag.
    유전자 동의어:BB138268, Mmp8
    :Mouse
    벡터:pCMV3-C-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MMP8 qPCR primers for gene expression analysis, MP200487 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    연구배경

    Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Neutrophil collagenase, also known as Matrix metalloproteinase-8, MMP-8, and CLG1, is a member of the peptidase M10A family. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 in the tumour may have a protective effect against lymph node metastasis. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 participates in wound repair by contributing to the resolution of inflammation and open the possibility to develop new strategies for treating wound healing defects.

    Size / Price
    Cat No: MG50493-CY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".