MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52943-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MSRA/Methionine Mulfoxide Reductase A Reagents
CRO Services
Product recommended

All MSRA/Methionine Mulfoxide Reductase A Reagents
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
702 bp
Description
Full length Clone DNA of Mouse methionine sulfoxide reductase A with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2310045J23Rik cDNA ORF Clone, Mouse;6530413P12Rik cDNA ORF Clone, Mouse;MSR-A cDNA ORF Clone, Mouse
MSRA/Methionine Mulfoxide Reductase A Background Information
Full Name
methionine sulfoxide reductase A

MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone in Cloning Vector, Cynomolgus CG90429-G
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, untagged CG90429-UT
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90429-ACG
MSRA/Methionine Mulfoxide Reductase A Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90429-ACGLN
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90429-ANG
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90429-ACR
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90429-ANR
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90429-CF
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90429-NF
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-His tag CG90429-CH
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-His tag CG90429-NH
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-HA tag CG90429-CY
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-HA tag CG90429-NY
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-Myc tag CG90429-CM
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-Myc tag CG90429-NM

MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone in Cloning Vector, Mouse MG52943-G
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, untagged MG52943-UT
MSRA/Methionine Mulfoxide Reductase A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52943-ACGLN
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52943-ACG
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52943-ACR
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52943-CF
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-His tag MG52943-CH
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, N-His tag MG52943-NH
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-HA tag MG52943-CY
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, N-HA tag MG52943-NY
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-Myc tag MG52943-CM
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, N-Myc tag MG52943-NM

MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Human, untagged HG18386-UT
info info
添加购物车成功! 添加购物车失败!