MTPN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52778-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MTPN Reagents
CRO Services
Product recommended

All MTPN Reagents
MTPN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
357 bp
Description
Full length Clone DNA of Mouse myotrophin with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MTPN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
5033418D15Rik cDNA ORF Clone, Mouse;Gcdp cDNA ORF Clone, Mouse;V1 cDNA ORF Clone, Mouse
MTPN Background Information
Full Name
myotrophin

MTPN cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
MTPN cDNA ORF Clone in Cloning Vector, Rhesus CG90383-G
MTPN cDNA ORF Clone, Rhesus, untagged CG90383-UT
MTPN cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90383-ACG
MTPN Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90383-ACGLN
MTPN cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90383-ANG
MTPN cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90383-ACR
MTPN cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90383-ANR
MTPN cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90383-CF
MTPN cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90383-NF
MTPN cDNA ORF Clone, Rhesus, C-His tag CG90383-CH
MTPN cDNA ORF Clone, Rhesus, N-His tag CG90383-NH
MTPN cDNA ORF Clone, Rhesus, C-HA tag CG90383-CY
MTPN cDNA ORF Clone, Rhesus, N-HA tag CG90383-NY
MTPN cDNA ORF Clone, Rhesus, C-Myc tag CG90383-CM
MTPN cDNA ORF Clone, Rhesus, N-Myc tag CG90383-NM

MTPN cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MTPN cDNA ORF Clone in Cloning Vector, Mouse MG52778-G
MTPN cDNA ORF Clone, Mouse, untagged MG52778-UT
MTPN Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52778-ACGLN
MTPN cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52778-ACG
MTPN cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52778-ACR
MTPN cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52778-NF
MTPN cDNA ORF Clone, Mouse, C-His tag MG52778-CH
MTPN cDNA ORF Clone, Mouse, N-His tag MG52778-NH
MTPN cDNA ORF Clone, Mouse, C-HA tag MG52778-CY
MTPN cDNA ORF Clone, Mouse, N-HA tag MG52778-NY
MTPN cDNA ORF Clone, Mouse, C-Myc tag MG52778-CM
MTPN cDNA ORF Clone, Mouse, N-Myc tag MG52778-NM

MTPN cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MTPN cDNA ORF Clone, Human, untagged HG21019-UT
info info
添加购物车成功! 添加购物车失败!