MYL12B cDNA ORF Clone, Mouse, N-His tag

Cat: MG50729-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MYL12B Reagents

CRO Services

Product recommended


All MYL12B Reagents

MYL12B cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
519 bp
Description
Full length Clone DNA of Mouse myosin, light chain 12B, regulatory with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MYL12B cDNA ORF Clone, Mouse, N-His tag Alternative Names

1500001M02Rik cDNA ORF Clone, Mouse;C77744 cDNA ORF Clone, Mouse;Mylc2b cDNA ORF Clone, Mouse;RLC-B cDNA ORF Clone, Mouse

MYL12B Background Information

Full Name
myosin, light chain 12B, regulatory

MYL12B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MYL12B cDNA ORF Clone in Cloning Vector, Mouse MG50729-G
MYL12B cDNA ORF Clone, Mouse, untagged MG50729-UT
MYL12B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50729-ACGLN
MYL12B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50729-ACG
MYL12B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50729-ANG
MYL12B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50729-ACR
MYL12B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50729-ANR
MYL12B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50729-CF
MYL12B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50729-NF
MYL12B cDNA ORF Clone, Mouse, C-His tag MG50729-CH
MYL12B cDNA ORF Clone, Mouse, C-HA tag MG50729-CY
MYL12B cDNA ORF Clone, Mouse, N-HA tag MG50729-NY
MYL12B cDNA ORF Clone, Mouse, C-Myc tag MG50729-CM
MYL12B cDNA ORF Clone, Mouse, N-Myc tag MG50729-NM
MYL12B qPCR Primer Pairs, Mouse MP200704

MYL12B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MYL12B cDNA ORF Clone in Cloning Vector, Human HG16303-U
MYL12B cDNA ORF Clone, Human, untagged HG16303-UT
MYL12B cDNA ORF Clone, Human, C-GFPSpark® tag HG16303-ACG
MYL12B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16303-ACGLN
MYL12B cDNA ORF Clone, Human, N-GFPSpark® tag HG16303-ANG
MYL12B cDNA ORF Clone, Human, C-OFPSpark® tag HG16303-ACR
MYL12B cDNA ORF Clone, Human, N-OFPSpark® tag HG16303-ANR
MYL12B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16303-CF
MYL12B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16303-NF
MYL12B cDNA ORF Clone, Human, C-His tag HG16303-CH
MYL12B cDNA ORF Clone, Human, N-His tag HG16303-NH
MYL12B cDNA ORF Clone, Human, C-HA tag HG16303-CY
MYL12B cDNA ORF Clone, Human, N-HA tag HG16303-NY
MYL12B cDNA ORF Clone, Human, C-Myc tag HG16303-CM
MYL12B cDNA ORF Clone, Human, N-Myc tag HG16303-NM
MYL12B qPCR Primer Pairs, Human HP105057
info info
添加购物车成功! 添加购物车失败!