NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, C-His tag

Price:
Size:
Number:

NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1380 bp
Description
Full length Clone DNA of Mouse nucleobindin 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, C-His tag: Alternative Names

B230337F23Rik cDNA ORF Clone, Mouse; C77483 cDNA ORF Clone, Mouse; Calnuc cDNA ORF Clone, Mouse; MTEST82 cDNA ORF Clone, Mouse; Nucb cDNA ORF Clone, Mouse

NUCB1/Nucleobindin 1 Background Information

NUCB1/Nucleobindin 1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait