NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51629-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NXT2/NTF2-related export protein 2 Reagents
CRO Services
Product recommended

All NXT2/NTF2-related export protein 2 Reagents
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
429 bp
Description
Full length Clone DNA of Mouse nuclear transport factor 2-like export factor 2
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
6330587F24Rik cDNA ORF Clone, Mouse;AI787442 cDNA ORF Clone, Mouse;P15-2 cDNA ORF Clone, Mouse
NXT2/NTF2-related export protein 2 Background Information
Full Name
nuclear transport factor 2-like export factor 2

NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NXT2/NTF2-related export protein 2 cDNA ORF Clone in Cloning Vector, Mouse MG51629-U
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, untagged MG51629-UT
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51629-ACG
NXT2/NTF2-related export protein 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51629-ACGLN
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51629-ANG
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51629-ACR
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51629-ANR
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51629-CF
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51629-NF
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, C-His tag MG51629-CH
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, N-His tag MG51629-NH
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, C-HA tag MG51629-CY
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, N-HA tag MG51629-NY
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Mouse, N-Myc tag MG51629-NM
NXT2/NTF2-related export protein 2 qPCR Primer Pairs, Mouse MP201502

NXT2/NTF2-related export protein 2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NXT2/NTF2-related export protein 2 cDNA ORF Clone, Human, untagged HG24998-UT
info info
添加购物车成功! 添加购物车失败!