OCRL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51076-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OCRL Reagents
CRO Services
Product recommended

All OCRL Reagents
OCRL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2703 bp
Description
Full length Clone DNA of Mouse oculocerebrorenal syndrome of Lowe with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OCRL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
9530014D17Rik cDNA ORF Clone, Mouse;BB143339 cDNA ORF Clone, Mouse;OCRL1 cDNA ORF Clone, Mouse
OCRL Background Information
Full Name
oculocerebrorenal syndrome of Lowe

OCRL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OCRL cDNA ORF Clone in Cloning Vector, Mouse MG51076-G
OCRL cDNA ORF Clone, Mouse, untagged MG51076-UT
OCRL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51076-ACGLN
OCRL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51076-ACG
OCRL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51076-ANG
OCRL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51076-ACR
OCRL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51076-ANR
OCRL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51076-CF
OCRL cDNA ORF Clone, Mouse, C-His tag MG51076-CH
OCRL cDNA ORF Clone, Mouse, N-His tag MG51076-NH
OCRL cDNA ORF Clone, Mouse, C-HA tag MG51076-CY
OCRL cDNA ORF Clone, Mouse, N-HA tag MG51076-NY
OCRL cDNA ORF Clone, Mouse, C-Myc tag MG51076-CM
OCRL cDNA ORF Clone, Mouse, N-Myc tag MG51076-NM
OCRL qPCR Primer Pairs, Mouse MP201034

OCRL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OCRL cDNA ORF Clone in Cloning Vector, Human HG10515-M
OCRL cDNA ORF Clone, Human, untagged HG10515-UT
OCRL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10515-ACGLN
OCRL cDNA ORF Clone, Human, C-GFPSpark® tag HG10515-ACG
OCRL cDNA ORF Clone, Human, N-GFPSpark® tag HG10515-ANG
OCRL cDNA ORF Clone, Human, C-OFPSpark® tag HG10515-ACR
OCRL cDNA ORF Clone, Human, N-OFPSpark® tag HG10515-ANR
OCRL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10515-CF
OCRL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10515-NF
OCRL cDNA ORF Clone, Human, C-His tag HG10515-CH
OCRL cDNA ORF Clone, Human, N-His tag HG10515-NH
OCRL cDNA ORF Clone, Human, C-HA tag HG10515-CY
OCRL cDNA ORF Clone, Human, N-HA tag HG10515-NY
OCRL cDNA ORF Clone, Human, C-Myc tag HG10515-CM
OCRL cDNA ORF Clone, Human, N-Myc tag HG10515-NM
OCRL qPCR Primer Pairs, Human HP100535
info info
添加购物车成功! 添加购物车失败!