After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 Osteomodulin Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Mouse OMD cDNA 클론 제품 정보
Gene_bank_ref_id:NM_012050.1
cDNA 크기:1272bp
cDNA 설명:Full length Clone DNA of Mus musculus osteomodulin with N terminal Flag tag.
유전자 동의어:OSAD, SLRR2C
:Mouse
벡터:pCMV3-SP-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Osteomodulin (OMD), also known as Osteoadherin (OSAD), Keratan sulfate proteoglycan osteomodulin, KSPG osteomodulin, and SLRR2C, is a secreted protein which belongs to the small leucine-rich proteoglycan (SLRP) family and Class II subfamily. SLRP family proteins are normally found in extracellular matrices, but Osteomodulin is the only member restricted to mineralized tissues. Osteomodulin is primarily expressed by osteoblasts and might have a role in regulation of mineralization. In bone OSAD has been localized in primary spongiosa within the bovine fetal rib growth plate. Moreover, in situ hybridization has shown expression of OSAD in osteoblasts close to the cartilage and bone border in the growth plate of rat femur. OSAD may play an important role during tooth development and biomineralization of dentin. Osteomodulin is a cell binding keratan sulfate proteoglycan which was recently isolated from mineralized bovine bone and subsequently cloned and sequenced. Osteomodulin may be implicated in biomineralization processes. It has a function in binding of osteoblasts via the alpha (V) beta (3)-integrin. It is likely that Osteomodulin is an osteoblast maturation marker that is induced by osteoclast activity. Osteomodulin is also an early marker for terminally differentiated matrix producing osteoblasts.

참고자료
  • Buchaille R, et al. (2000) Expression of the small leucine-rich proteoglycan osteoadherin/osteomodulin in human dental pulp and developing rat teeth. Bone. 27(2): 265-70.
  • Petersson U, et al. (2003) Identification, distribution and expression of osteoadherin during tooth formation. Eur J Oral Sci. 111(2): 128-36.
  • Rehn AP, et al. (2006) Differential regulation of osteoadherin (OSAD) by TGF-beta1 and BMP-2. Biochem Biophys Res Commun. 349(3): 1057-64.
  • Size / Price
    Cat No: MG50451-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".