PDCD2L/MGC13096 cDNA ORF Clone, Mouse, untagged

Cat: MG51354-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDCD2L/MGC13096 Reagents
CRO Services
Product recommended

All PDCD2L/MGC13096 Reagents
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1095 bp
Description
Full length Clone DNA of Mouse programmed cell death 2-like.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDCD2L/MGC13096 cDNA ORF Clone, Mouse, untagged Alternative Names
6030457N17Rik cDNA ORF Clone, Mouse
PDCD2L/MGC13096 Background Information
Full Name
programmed cell death 2-like

PDCD2L/MGC13096 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDCD2L/MGC13096 cDNA ORF Clone in Cloning Vector, Mouse MG51354-U
PDCD2L/MGC13096 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51354-ACGLN
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51354-ACG
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51354-ANG
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51354-ACR
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51354-ANR
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51354-CF
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51354-NF
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, C-His tag MG51354-CH
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, N-His tag MG51354-NH
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, C-HA tag MG51354-CY
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, N-HA tag MG51354-NY
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, C-Myc tag MG51354-CM
PDCD2L/MGC13096 cDNA ORF Clone, Mouse, N-Myc tag MG51354-NM
PDCD2L/MGC13096 qPCR Primer Pairs, Mouse MP201231

PDCD2L/MGC13096 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDCD2L/MGC13096 cDNA ORF Clone in Cloning Vector, Human HG17144-U
PDCD2L/MGC13096 cDNA ORF Clone, Human, untagged HG17144-UT
PDCD2L/MGC13096 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17144-ACGLN
PDCD2L/MGC13096 cDNA ORF Clone, Human, C-GFPSpark® tag HG17144-ACG
PDCD2L/MGC13096 cDNA ORF Clone, Human, N-GFPSpark® tag HG17144-ANG
PDCD2L/MGC13096 cDNA ORF Clone, Human, C-OFPSpark® tag HG17144-ACR
PDCD2L/MGC13096 cDNA ORF Clone, Human, N-OFPSpark® tag HG17144-ANR
PDCD2L/MGC13096 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17144-CF
PDCD2L/MGC13096 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17144-NF
PDCD2L/MGC13096 cDNA ORF Clone, Human, C-His tag HG17144-CH
PDCD2L/MGC13096 cDNA ORF Clone, Human, N-His tag HG17144-NH
PDCD2L/MGC13096 cDNA ORF Clone, Human, C-HA tag HG17144-CY
PDCD2L/MGC13096 cDNA ORF Clone, Human, N-HA tag HG17144-NY
PDCD2L/MGC13096 cDNA ORF Clone, Human, C-Myc tag HG17144-CM
PDCD2L/MGC13096 cDNA ORF Clone, Human, N-Myc tag HG17144-NM
info info
添加购物车成功! 添加购物车失败!