PDGFA cDNA ORF Clone, Mouse, C-His tag

Cat: MG50447-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PDGFA Reagents

CRO Services

Product recommended


All PDGFA Reagents

PDGFA cDNA ORF Clone, Mouse, C-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
591 bp
Description
Full length Clone DNA of Mouse platelet derived growth factor, alpha with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDGFA Background Information

Full Name
platelet-derived growth factor alpha polypeptide

PDGFA cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PDGFA cDNA ORF Clone in Cloning Vector, Canine DG70052-G
PDGFA cDNA ORF Clone, Canine, untagged DG70052-UT
PDGFA cDNA ORF Clone, Canine, C-GFPSpark® tag DG70052-ACG
PDGFA Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70052-ACGLN
PDGFA cDNA ORF Clone, Canine, C-OFPSpark® tag DG70052-ACR
PDGFA cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70052-CF
PDGFA cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70052-NF
PDGFA cDNA ORF Clone, Canine, C-His tag DG70052-CH
PDGFA cDNA ORF Clone, Canine, N-His tag DG70052-NH
PDGFA cDNA ORF Clone, Canine, C-HA tag DG70052-CY
PDGFA cDNA ORF Clone, Canine, N-HA tag DG70052-NY
PDGFA cDNA ORF Clone, Canine, C-Myc tag DG70052-CM
PDGFA cDNA ORF Clone, Canine, N-Myc tag DG70052-NM

PDGFA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PDGFA cDNA ORF Clone in Cloning Vector, Rat RG80068-M
PDGFA cDNA ORF Clone, Rat, untagged RG80068-UT
PDGFA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80068-ACG
PDGFA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80068-ACGLN
PDGFA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80068-ACR
PDGFA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80068-CF
PDGFA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80068-NF
PDGFA cDNA ORF Clone, Rat, C-His tag RG80068-CH
PDGFA cDNA ORF Clone, Rat, N-His tag RG80068-NH
PDGFA cDNA ORF Clone, Rat, C-HA tag RG80068-CY
PDGFA cDNA ORF Clone, Rat, N-HA tag RG80068-NY
PDGFA cDNA ORF Clone, Rat, C-Myc tag RG80068-CM
PDGFA cDNA ORF Clone, Rat, N-Myc tag RG80068-NM
PDGFA qPCR Primer Pairs, Rat RP300066

PDGFA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDGFA cDNA ORF Clone in Cloning Vector, Mouse MG50447-M
PDGFA cDNA ORF Clone, Mouse, untagged MG50447-UT
PDGFA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50447-ACG
PDGFA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50447-ACGLN
PDGFA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50447-ACR
PDGFA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50447-CF
PDGFA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50447-NF
PDGFA cDNA ORF Clone, Mouse, N-His tag MG50447-NH
PDGFA cDNA ORF Clone, Mouse, C-HA tag MG50447-CY
PDGFA cDNA ORF Clone, Mouse, N-HA tag MG50447-NY
PDGFA cDNA ORF Clone, Mouse, C-Myc tag MG50447-CM
PDGFA cDNA ORF Clone, Mouse, N-Myc tag MG50447-NM
PDGFA qPCR Primer Pairs, Mouse MP200456

PDGFA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDGFA cDNA ORF Clone in Cloning Vector, Human HG13081-G
PDGFA cDNA ORF Clone, Human, untagged HG13081-UT
PDGFA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13081-ACGLN
PDGFA cDNA ORF Clone, Human, C-GFPSpark® tag HG13081-ACG
PDGFA cDNA ORF Clone, Human, C-OFPSpark® tag HG13081-ACR
PDGFA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13081-CF
PDGFA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13081-NF
PDGFA cDNA ORF Clone, Human, C-His tag HG13081-CH
PDGFA cDNA ORF Clone, Human, N-His tag HG13081-NH
PDGFA cDNA ORF Clone, Human, C-HA tag HG13081-CY
PDGFA cDNA ORF Clone, Human, N-HA tag HG13081-NY
PDGFA cDNA ORF Clone, Human, C-Myc tag HG13081-CM
PDGFA cDNA ORF Clone, Human, N-Myc tag HG13081-NM
PDGFA qPCR Primer Pairs, Human HP101698
info info
添加购物车成功! 添加购物车失败!