쥐 PEBP1/RKIP Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
     PEBP1 cDNA 클론 제품 정보
    Gene_bank_ref_id:AB046417.1
    cDNA 크기:564bp
    cDNA 설명:Full length Clone DNA of Mus musculus phosphatidylethanolamine binding protein 1.
    유전자 동의어:Pbp, HCNP, Pbp1, Pbpr, Rkip
    :Mouse
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PEBP1 qPCR primers for gene expression analysis, MP201224 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Size / Price
    Cat No: MG51347-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".