After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 PGF Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Mouse PGF cDNA 클론 제품 정보
Gene_bank_ref_id:NM_008827.2
cDNA 크기:477bp
cDNA 설명:Full length Clone DNA of Mus musculus placental growth factor with N terminal His tag.
유전자 동의어:PIGF, Plgf, AI854365, Pgf
:Mouse
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
참고자료
  • Nagy JA, et al. (2003) VEGF-A(164/165) and PlGF: roles in angiogenesis and arteriogenesis. Trends Cardiovasc Med. 13(5): 169-75.
  • Chaballe L, et al. (2011) Placental growth factor: a tissue modelling factor with therapeutic potentials in neurology? Acta Neurol Belg. 111(1): 10-7.
  • Odorisio T, et al. (2006) The placenta growth factor in skin angiogenesis. J Dermatol Sci. 41(1): 11-9.
  • Size / Price
    Cat No: MG50125-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".