Text Size:AAA

쥐 PIGR Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
 PIGR cDNA 클론 제품 정보
Gene_bank_ref_id:NM_011082.2
cDNA 크기:2316bp
cDNA 설명:Full length Clone DNA of Mus musculus polymeric immunoglobulin receptor with N terminal His tag.
유전자 동의어:PIGR
:Mouse
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PIGR qPCR primers for gene expression analysis, MP200149 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Polymeric immunoglobulin receptor, also known as PIGR, is a member of the immunoglobulin superfamily and a Fc receptor. The ectodomain of this receptor consists of five units with homology to the variable units of immunoglobulins and a transmembrane region, which also has some homology to certain immunoglobulin variable regions. PIGR is expressed on several glandular epithelia including those of liver and breast. The deduced amino-acid sequence has a length of 764 residues and shows an overall similarity of 56% and 64% with the rabbit and rat counterpart. PIGR mediates transcellular transport of polymeric immunoglobulin molecules, and thus facilitates the secretion of IgA and IgM. During this process, a cleavage occurs that separates the extracellular (known as the secretory component) from the transmembrane segment of PIGR.

참고자료
  • Coyne, R. S. et al., 1995, J. Biol. Chem. 269 (50) :31620-31625. 
  • Kaetzel,C.S., 2001,  Curr Biol. 11(1): R35-38.
  • Size / Price
    Cat No: MG50119-NH
    정가: 
    가격:      (You Save: )
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".