After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 PLA2G2A Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Mouse PLA2G2A cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001082531.1
cDNA 크기:441bp
cDNA 설명:Full length Clone DNA of Mus musculus phospholipase A2, group IIA (platelets, synovial fluid) with N terminal Myc tag.
유전자 동의어:EF, Mom1, Pla2, sPLA2, sPla2-IIA, Pla2g2a
:Mouse
벡터:pCMV3-SP-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Phospholipase A2, membrane associated, also known as Phosphatidylcholine 2-acylhydrolase 2A, Group IIA phospholipase A2, Non-pancreatic secretory phospholipase A2 and PLA2G2A, is a peripheral membrane protein which belongs to the phospholipase A2 family. PLA2G2A is found in many cells and also extracellularly. The membrane-bound and secreted forms of PLA2G2A are identical. PLA2G2A has been proposed to play a role in anti-bacterial defense, inflammation and eicosanoid generation, in clearance of apoptotic cells, and in the Wnt signaling pathway. PLA2G2A is thought to participate in the regulation of the phospholipid metabolism in biomembranes including eicosanoid biosynthesis. PLA2G2A catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides. PLA2G2A might be a factor in human colorectal tumorigenesis.

참고자료
  • Praml,C. et al., 1998, Oncogene. 17 (15):2009-12.
  • Fijneman,R.J. et al., 2008,Front Biosci 13 :4144-74.
  • Fijneman,R.J. et al., 2009, Cell Oncol  31 (5):345-56.
  • Size / Price
    Cat No: MG50203-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".