POLR3C cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51462-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All POLR3C Reagents
CRO Services
Product recommended

All POLR3C Reagents
POLR3C cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1602 bp
Description
Full length Clone DNA of Mouse polymerase (RNA) III (DNA directed) polypeptide C with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

POLR3C cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
4933407E01Rik cDNA ORF Clone, Mouse;RPC3 cDNA ORF Clone, Mouse;RPC62 cDNA ORF Clone, Mouse
POLR3C Background Information
Full Name
polymerase (RNA) III (DNA directed) polypeptide C (62kD)

POLR3C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
POLR3C cDNA ORF Clone in Cloning Vector, Mouse MG51462-G
POLR3C cDNA ORF Clone, Mouse, untagged MG51462-UT
POLR3C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51462-ACGLN
POLR3C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51462-ACG
POLR3C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51462-ANG
POLR3C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51462-ACR
POLR3C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51462-ANR
POLR3C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51462-CF
POLR3C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51462-NF
POLR3C cDNA ORF Clone, Mouse, C-His tag MG51462-CH
POLR3C cDNA ORF Clone, Mouse, N-His tag MG51462-NH
POLR3C cDNA ORF Clone, Mouse, C-HA tag MG51462-CY
POLR3C cDNA ORF Clone, Mouse, N-HA tag MG51462-NY
POLR3C cDNA ORF Clone, Mouse, C-Myc tag MG51462-CM
POLR3C qPCR Primer Pairs, Mouse MP201346

POLR3C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
POLR3C cDNA ORF Clone in Cloning Vector, Human HG22852-U
POLR3C cDNA ORF Clone, Human, untagged HG22852-UT
POLR3C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22852-ACGLN
POLR3C cDNA ORF Clone, Human, C-GFPSpark® tag HG22852-ACG
POLR3C cDNA ORF Clone, Human, N-GFPSpark® tag HG22852-ANG
POLR3C cDNA ORF Clone, Human, C-OFPSpark® tag HG22852-ACR
POLR3C cDNA ORF Clone, Human, N-OFPSpark® tag HG22852-ANR
POLR3C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22852-CF
POLR3C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22852-NF
POLR3C cDNA ORF Clone, Human, C-His tag HG22852-CH
POLR3C cDNA ORF Clone, Human, N-His tag HG22852-NH
POLR3C cDNA ORF Clone, Human, C-HA tag HG22852-CY
POLR3C cDNA ORF Clone, Human, N-HA tag HG22852-NY
POLR3C cDNA ORF Clone, Human, C-Myc tag HG22852-CM
POLR3C cDNA ORF Clone, Human, N-Myc tag HG22852-NM
info info
添加购物车成功! 添加购物车失败!