쥐 PPM1A/PP2CA Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Mouse PPM1A cDNA 클론 제품 정보
Gene_bank_ref_id:NM_008910.2
cDNA 크기:1149bp
cDNA 설명:Full length Clone DNA of Mus musculus protein phosphatase 1A, magnesium dependent, alpha isoform with N terminal His tag.
유전자 동의어:MMPa-2, MPPa-1, AI427932, AU017636, 2310003C21Rik, 2900017D14Rik, Ppm1a
:Mouse
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Protein phosphatase 1A (PPM1A / PP2CA) is an enzyme belonging to the PP2C family of Ser / Thr protein phosphatases. Members of PP2C family are negative regulators of cell stress response pathways and the MAP kinases and MAP kinase kinases. It has also been demonstrated to inhibit the activation of p38 and JNK kinase cascades. PPM1A dephosphorylates and promotes nuclear export of TGFβ-activated Smad2/3. Ectopic expression of PPM1A abolishes TGFβ-induced antiproliferative and transcriptional responses, whereas depletion of PPM1A enhances TGFβ signaling in mammalian cells. It has been demonstrated that PPM1A / PP2CA, through dephosphorylation of Smad2/3, plays a critical role in terminating TGFβ signaling. Overexpression of PPM1A is reported to activate the expression of the tumor suppressor gene TP53 / p53, which leads to cell apoptosis.

참고자료
  • Lin X, et al. (2006) PPM1A functions as a Smad phosphatase to terminate TGFbeta signaling. Cell. 125(5): 915-28.
  • Marc F, et al. (2003) Protein phosphatase 2C binds selectively to and dephosphorylates metabotropic glutamate receptor 3. Proc Natl Acad. 100 (26): 16006-11.
  • Mann DJ, et al. (1992) Mammalian protein serine/threonine phosphatase 2C: cDNA cloning and comparative analysis of amino acid sequences. Biochim Biophys Acta. 1130 (1): 100-4.
  • Size / Price
    Cat No: MG50277-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".