PPM1A cDNA ORF Clone, Mouse, N-His tag

Cat: MG50277-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PPM1A Reagents

CRO Services

Product recommended


All PPM1A Reagents

PPM1A cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1149 bp
Description
Full length Clone DNA of Mouse protein phosphatase 1A, magnesium dependent, alpha isoform with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPM1A cDNA ORF Clone, Mouse, N-His tag Alternative Names

2310003C21Rik cDNA ORF Clone, Mouse;2900017D14Rik cDNA ORF Clone, Mouse;AI427932 cDNA ORF Clone, Mouse;AU017636 cDNA ORF Clone, Mouse;MMPa-2 cDNA ORF Clone, Mouse;MPPa-1 cDNA ORF Clone, Mouse

PPM1A Background Information

Protein phosphatase 1A (PPM1A / PP2CA) is an enzyme belonging to the PP2C family of Ser / Thr protein phosphatases. Members of PP2C family are negative regulators of cell stress response pathways and the MAP kinases and MAP kinase kinases. It has also been demonstrated to inhibit the activation of p38 and JNK kinase cascades. PPM1A dephosphorylates and promotes nuclear export of TGFβ-activated Smad2/3. Ectopic expression of PPM1A abolishes TGFβ-induced antiproliferative and transcriptional responses, whereas depletion of PPM1A enhances TGFβ signaling in mammalian cells. It has been demonstrated that PPM1A / PP2CA, through dephosphorylation of Smad2/3, plays a critical role in terminating TGFβ signaling. Overexpression of PPM1A is reported to activate the expression of the tumor suppressor gene TP53 / p53, which leads to cell apoptosis.

Full Name
protein phosphatase, Mg2+/Mn2+ dependent, 1A
References
  • Lin X, et al. (2006) PPM1A functions as a Smad phosphatase to terminate TGFbeta signaling. Cell. 125(5): 915-28.
  • Marc F, et al. (2003) Protein phosphatase 2C binds selectively to and dephosphorylates metabotropic glutamate receptor 3. Proc Natl Acad. 100 (26): 16006-11.
  • Mann DJ, et al. (1992) Mammalian protein serine/threonine phosphatase 2C: cDNA cloning and comparative analysis of amino acid sequences. Biochim Biophys Acta. 1130 (1): 100-4.
  • info info
    添加购物车成功! 添加购物车失败!