After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 Peroxiredoxin 5/PRDX5 Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Mouse PRDX5 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_012021.2
cDNA 크기:633bp
cDNA 설명:Full length Clone DNA of Mus musculus peroxiredoxin 5 with N terminal HA tag.
유전자 동의어:AOPP, PrxV, Pmp20, Prdx6, AOEB166, Prdx5
:Mouse
벡터:pCMV3-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

Peroxiredoxin-5, also known as Alu corepressor 1, Antioxidant enzyme B166, Liver tissue 2D-page spot 71B, Peroxisomal antioxidant enzyme, Thioredoxin peroxidase PMP20, Thioredoxin reductase, PRDX5 and ACR1, is cytoplasm protein which belongs to the?peroxiredoxin 2 family. Peroxiredoxin-5 / PRDX5 reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-5 / PRDX5 is involved in intracellular redox signaling. The Peroxiredoxins / Prx are a family of 25 kDa peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

참고자료
  • Seo M.S., et al., 2000, J. Biol. Chem. 275: 20346-54.
  • Declercq J.-P., et al., 2001, J. Mol. Biol. 311:751-9.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Size / Price
    Cat No: MG50551-NY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".