Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51391-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Peroxiredoxin 6 Reagents
CRO Services
Product recommended

All Peroxiredoxin 6 Reagents
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Mouse peroxiredoxin 6 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1-CysPrx cDNA ORF Clone, Mouse;9430088D19Rik cDNA ORF Clone, Mouse;AA690119 cDNA ORF Clone, Mouse;aiPLA2 cDNA ORF Clone, Mouse;Aop2 cDNA ORF Clone, Mouse;Brp-12 cDNA ORF Clone, Mouse;CP-3 cDNA ORF Clone, Mouse;GPx cDNA ORF Clone, Mouse;Ltw-4 cDNA ORF Clone, Mouse;Ltw4 cDNA ORF Clone, Mouse;Lvtw-4 cDNA ORF Clone, Mouse;NSGPx cDNA ORF Clone, Mouse;ORF06 cDNA ORF Clone, Mouse;Prdx5 cDNA ORF Clone, Mouse
Peroxiredoxin 6 Background Information
Full Name
peroxiredoxin 6

Peroxiredoxin 6 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
Peroxiredoxin 6 cDNA ORF Clone in Cloning Vector, Ferret FG60124-G
Peroxiredoxin 6 cDNA ORF Clone, Ferret, untagged FG60124-UT
Peroxiredoxin 6 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60124-ACGLN
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60124-ACG
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60124-ANG
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60124-ACR
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60124-ANR
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60124-CF
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60124-NF
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-His tag FG60124-CH
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-His tag FG60124-NH
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-HA tag FG60124-CY
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-HA tag FG60124-NY
Peroxiredoxin 6 cDNA ORF Clone, Ferret, C-Myc tag FG60124-CM
Peroxiredoxin 6 cDNA ORF Clone, Ferret, N-Myc tag FG60124-NM

Peroxiredoxin 6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Peroxiredoxin 6 cDNA ORF Clone in Cloning Vector, Rat RG82760-U
Peroxiredoxin 6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82760-ACGLN

Peroxiredoxin 6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Peroxiredoxin 6 cDNA ORF Clone in Cloning Vector, Mouse MG51391-G
Peroxiredoxin 6 cDNA ORF Clone, Mouse, untagged MG51391-UT
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51391-ACG
Peroxiredoxin 6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51391-ACGLN
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51391-ANG
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51391-ACR
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51391-ANR
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51391-CF
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51391-NF
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-His tag MG51391-CH
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-HA tag MG51391-CY
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-HA tag MG51391-NY
Peroxiredoxin 6 cDNA ORF Clone, Mouse, C-Myc tag MG51391-CM
Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-Myc tag MG51391-NM
Peroxiredoxin 6 qPCR Primer Pairs, Mouse MP201282

Peroxiredoxin 6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Peroxiredoxin 6 cDNA ORF Clone in Cloning Vector, Human HG11257-M
Peroxiredoxin 6 cDNA ORF Clone, Human, untagged HG11257-UT
Peroxiredoxin 6 cDNA ORF Clone, Human, C-GFPSpark® tag HG11257-ACG
Peroxiredoxin 6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11257-ACGLN
Peroxiredoxin 6 cDNA ORF Clone, Human, N-GFPSpark® tag HG11257-ANG
Peroxiredoxin 6 cDNA ORF Clone, Human, C-OFPSpark® tag HG11257-ACR
Peroxiredoxin 6 cDNA ORF Clone, Human, N-OFPSpark® tag HG11257-ANR
Peroxiredoxin 6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11257-CF
Peroxiredoxin 6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11257-NF
Peroxiredoxin 6 cDNA ORF Clone, Human, C-His tag HG11257-CH
Peroxiredoxin 6 cDNA ORF Clone, Human, N-His tag HG11257-NH
Peroxiredoxin 6 cDNA ORF Clone, Human, C-HA tag HG11257-CY
Peroxiredoxin 6 cDNA ORF Clone, Human, N-HA tag HG11257-NY
Peroxiredoxin 6 cDNA ORF Clone, Human, C-Myc tag HG11257-CM
Peroxiredoxin 6 cDNA ORF Clone, Human, N-Myc tag HG11257-NM
Peroxiredoxin 6 qPCR Primer Pairs, Human HP101141
info info
添加购物车成功! 添加购物车失败!