After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Mouse PREP cDNA 클론 제품 정보
Gene_bank_ref_id:NM_011156.2
cDNA 크기:2133bp
cDNA 설명:Full length Clone DNA of Mus musculus prolyl endopeptidase.
유전자 동의어:PEP, AI047692
:Mouse
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
쥐 Prolyl endopeptidase / PREP Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
연구배경

Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 10 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.

참고자료
  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".