PRKCZ / PKC zeta cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50790-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PRKCZ / PKC zeta Reagents

CRO Services

Product recommended


All PRKCZ / PKC zeta Reagents

PRKCZ / PKC zeta cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1230 bp
Description
Full length Clone DNA of Mouse protein kinase C, zeta with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRKCZ / PKC zeta cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

AI098070 cDNA ORF Clone, Mouse;aPKCzeta cDNA ORF Clone, Mouse;C80388 cDNA ORF Clone, Mouse;nPKC-zeta cDNA ORF Clone, Mouse;Pkcz cDNA ORF Clone, Mouse;R74924 cDNA ORF Clone, Mouse;zetaPKC cDNA ORF Clone, Mouse

PRKCZ / PKC zeta Background Information

Full Name
protein kinase C, zeta

PRKCZ / PKC zeta cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PRKCZ / PKC zeta cDNA ORF Clone, Rat, untagged RG81819-UT

PRKCZ / PKC zeta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRKCZ / PKC zeta cDNA ORF Clone in Cloning Vector, Mouse MG50790-G
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, untagged MG50790-UT
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50790-ACG
PRKCZ / PKC zeta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50790-ACGLN
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50790-ANG
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50790-ACR
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50790-ANR
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50790-CF
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50790-NF
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, C-His tag MG50790-CH
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, N-His tag MG50790-NH
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, C-HA tag MG50790-CY
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, N-HA tag MG50790-NY
PRKCZ / PKC zeta cDNA ORF Clone, Mouse, C-Myc tag MG50790-CM
PRKCZ / PKC zeta qPCR Primer Pairs, Mouse MP200763

PRKCZ / PKC zeta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRKCZ / PKC zeta cDNA ORF Clone in Cloning Vector, Human HG10541-G
PRKCZ / PKC zeta cDNA ORF Clone, Human, untagged HG10541-UT
PRKCZ / PKC zeta cDNA ORF Clone, Human, C-GFPSpark® tag HG10541-ACG
PRKCZ / PKC zeta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10541-ACGLN
PRKCZ / PKC zeta cDNA ORF Clone, Human, N-GFPSpark® tag HG10541-ANG
PRKCZ / PKC zeta cDNA ORF Clone, Human, C-OFPSpark® tag HG10541-ACR
PRKCZ / PKC zeta cDNA ORF Clone, Human, N-OFPSpark® tag HG10541-ANR
PRKCZ / PKC zeta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10541-CF
PRKCZ / PKC zeta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10541-NF
PRKCZ / PKC zeta cDNA ORF Clone, Human, C-His tag HG10541-CH
PRKCZ / PKC zeta cDNA ORF Clone, Human, N-His tag HG10541-NH
PRKCZ / PKC zeta cDNA ORF Clone, Human, C-HA tag HG10541-CY
PRKCZ / PKC zeta cDNA ORF Clone, Human, N-HA tag HG10541-NY
PRKCZ / PKC zeta cDNA ORF Clone, Human, C-Myc tag HG10541-CM
PRKCZ / PKC zeta cDNA ORF Clone, Human, N-Myc tag HG10541-NM
PRKCZ / PKC zeta qPCR Primer Pairs, Human HP100557
info info
添加购物车成功! 添加购物车失败!