PACT cDNA ORF Clone, Mouse, N-His tag

Cat: MG52537-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PACT Reagents

CRO Services

Product recommended


All PACT Reagents

PACT cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
942 bp
Description
Full length Clone DNA of Mouse protein kinase, interferon inducible double stranded RNA dependent activator with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PACT cDNA ORF Clone, Mouse, N-His tag Alternative Names

AV120107 cDNA ORF Clone, Mouse;lear cDNA ORF Clone, Mouse;Pact cDNA ORF Clone, Mouse;PRK cDNA ORF Clone, Mouse;RAX cDNA ORF Clone, Mouse

PACT Background Information

Full Name
protein kinase, interferon-inducible double stranded RNA dependent activator

PACT cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PACT cDNA ORF Clone in Cloning Vector, Rat RG81411-G

PACT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PACT cDNA ORF Clone in Cloning Vector, Mouse MG52537-G
PACT cDNA ORF Clone, Mouse, untagged MG52537-UT
PACT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52537-ACGLN
PACT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52537-ACG
PACT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52537-ANG
PACT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52537-ACR
PACT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52537-ANR
PACT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52537-CF
PACT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52537-NF
PACT cDNA ORF Clone, Mouse, C-His tag MG52537-CH
PACT cDNA ORF Clone, Mouse, C-HA tag MG52537-CY
PACT cDNA ORF Clone, Mouse, N-HA tag MG52537-NY
PACT cDNA ORF Clone, Mouse, C-Myc tag MG52537-CM
PACT cDNA ORF Clone, Mouse, N-Myc tag MG52537-NM
PACT qPCR Primer Pairs, Mouse MP202410

PACT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PACT cDNA ORF Clone in Cloning Vector, Human HG16816-U
PACT cDNA ORF Clone, Human, untagged HG16816-UT
PACT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16816-ACGLN
PACT cDNA ORF Clone, Human, C-GFPSpark® tag HG16816-ACG
PACT cDNA ORF Clone, Human, N-GFPSpark® tag HG16816-ANG
PACT cDNA ORF Clone, Human, C-OFPSpark® tag HG16816-ACR
PACT cDNA ORF Clone, Human, N-OFPSpark® tag HG16816-ANR
PACT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16816-CF
PACT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16816-NF
PACT cDNA ORF Clone, Human, C-His tag HG16816-CH
PACT cDNA ORF Clone, Human, N-His tag HG16816-NH
PACT cDNA ORF Clone, Human, C-HA tag HG16816-CY
PACT cDNA ORF Clone, Human, N-HA tag HG16816-NY
PACT cDNA ORF Clone, Human, C-Myc tag HG16816-CM
PACT cDNA ORF Clone, Human, N-Myc tag HG16816-NM
info info
添加购物车成功! 添加购物车失败!