PRRG2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51757-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PRRG2 Reagents

CRO Services

Product recommended


All PRRG2 Reagents

PRRG2 cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Mouse proline-rich Gla (G-carboxyglutamic acid) polypeptide 2 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRRG2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names

1600014G02Rik cDNA ORF Clone, Mouse;2510041M06Rik cDNA ORF Clone, Mouse;N4WBP1 cDNA ORF Clone, Mouse

PRRG2 Background Information

Full Name
proline rich Gla (G-carboxyglutamic acid) 2

PRRG2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRRG2 cDNA ORF Clone in Cloning Vector, Mouse MG51757-G
PRRG2 cDNA ORF Clone, Mouse, untagged MG51757-UT
PRRG2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51757-ACGLN
PRRG2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51757-ACG
PRRG2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51757-ACR
PRRG2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51757-CF
PRRG2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51757-NF
PRRG2 cDNA ORF Clone, Mouse, C-His tag MG51757-CH
PRRG2 cDNA ORF Clone, Mouse, N-His tag MG51757-NH
PRRG2 cDNA ORF Clone, Mouse, N-HA tag MG51757-NY
PRRG2 cDNA ORF Clone, Mouse, C-Myc tag MG51757-CM
PRRG2 cDNA ORF Clone, Mouse, N-Myc tag MG51757-NM
PRRG2 qPCR Primer Pairs, Mouse MP201630

PRRG2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRRG2 cDNA ORF Clone in Cloning Vector, Human HG13769-G
PRRG2 cDNA ORF Clone, Human, untagged HG13769-UT
PRRG2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13769-ACGLN
PRRG2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13769-ACG
PRRG2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13769-ACR
PRRG2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13769-CF
PRRG2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13769-NF
PRRG2 cDNA ORF Clone, Human, C-His tag HG13769-CH
PRRG2 cDNA ORF Clone, Human, N-His tag HG13769-NH
PRRG2 cDNA ORF Clone, Human, C-HA tag HG13769-CY
PRRG2 cDNA ORF Clone, Human, N-HA tag HG13769-NY
PRRG2 cDNA ORF Clone, Human, C-Myc tag HG13769-CM
PRRG2 cDNA ORF Clone, Human, N-Myc tag HG13769-NM
PRRG2 qPCR Primer Pairs, Human HP102444
info info
添加购物车成功! 添加购物车失败!