Text Size:AAA

쥐 PTMA Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Mouse PTMA cDNA 클론 제품 정보
Gene_bank_ref_id:NM_008972.2
cDNA 크기:336bp
cDNA 설명:Full length Clone DNA of Mus musculus prothymosin alpha.
유전자 동의어:Thym, MGC102090, MGC103390, Ptma
:Mouse
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

PTMA (prothymosin, alpha, N-GST chimera) is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin a1. Thymosins are named becaues they were originally isolated from the thymus. But now in many other tissues, thymosins also can be detected. Thymosins have diverse biological activities, and two in particular, thymosins a1 and _4, have potentially important uses in medicine, some of which have already progressed from the laboratory to the clinic. In general, PTMA is associated with cellular proliferation and carcinogenesis (Eschenfeldt et al., 1986), cellular and viral transcription (Cotter et al., 2000), protection against apoptosis and chromatin remodelling (Karetsou et al., 1998). PTMA may have a dual role both intracellulary and extracellulary. In relation to diseases, thymosins have been categorized as biological response modifiers. Thymosin a1 is derived from PTMA. For animals that lack thymus glands, thymosin a1 is responsible for the activity of that preparation in restoring immune function.

참고자료
  • Manrow RE, et al. (1992) The human prothymosin alpha gene family contains several processed pseudogenes lacking deleterious lesions. Genomics. 13(2):319-31.
  • Wara DW, et al. (1975) Thymosin activity in patients with cellular immunodeficiency. N Engl J Med. 292(2):70-4.
  • Garaci E, et al. (2007) Thymosin alpha 1: from bench to bedside. Ann N Y Acad Sci. 1112:225-34.
  • Goldstein AL, et al. (2009) From lab to bedside: emerging clinical applications of thymosin alpha 1. Expert Opin Biol Ther. 9(5):593-608.
  • Size / Price
    Cat No: MG50272-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".