After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Mouse PTPN11 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001109992.1
cDNA 크기:1782bp
cDNA 설명:Full length Clone DNA of Mus musculus protein tyrosine phosphatase, non-receptor type 11, transcript variant 2 with N terminal Flag tag.
유전자 동의어:Syp, Shp2, PTP1D, PTP2C, SAP-2, SHP-2, SH-PTP2, SH-PTP3
:Mouse
벡터:pCMV3-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그MG50462-ACG288840
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그MG50462-ACR288840
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그MG50462-ANG288840
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그MG50462-ANR288840
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그MG50462-CF253470
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His 태그MG50462-CH253470
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc 태그MG50462-CM253470
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA 태그MG50462-CY253470
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone in cloning vectorMG50462-M88420
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그MG50462-NF253470
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그MG50462-NH253470
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc 태그MG50462-NM253470
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA 태그MG50462-NY253470
쥐 SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmidMG50462-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

SHP2, also known as PTPN11, belongs to the protein-tyrosine phosphatase(PTP) family, non-receptor class 2 subfamily. PTPs catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They dephosphorylate EGFR, JAK2 and TYK2 kinases, promoting oncogenic transformation. SHP2 is widely expressed, with highest levels in heart, brain, and skeletal muscle. SHP2 acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. It also dephosphorylates ROCK2 at Tyr-722 resulting in stimulatation of its RhoA binding activity.

참고자료
  • Ganju R K, et al. (2000) Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem. 275(23):17263-8.
  • Yin T, et al. (1997) Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases. J Biol Chem. 272(2):1032-7.
  • Kontaridis MI, et al. (2006) PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281(10):6785-92.
  • Size / Price
    Cat No: MG50462-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".