After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 PGLYRP1/PGRP-S Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Mouse PGLYRP1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_009402.2
cDNA 크기:549bp
cDNA 설명:Full length Clone DNA of Mus musculus peptidoglycan recognition protein 1 with N terminal His tag.
유전자 동의어:PGRP, Tag7, Tasg7, PGRP-S, Pglyrp, Tnfsf3l
:Mouse
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Mouse Peptidoglycan recognition protein 1, also known as Peptidoglycan recognition protein short, PGRP-S, PGLYRP1, PGLYRP, PGRP and TNFSF3L, is a secreted protein which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. PGLYRP1 / PGLYRP is highly expressed in bone marrow. It is weakly expressed in kidney, liver, small intestine, spleen, thymus, peripheral leukocyte, lung, fetal spleen and neutrophils. PGLYRP1 / PGLYRP is a pattern receptor that binds to murein peptidoglycans (PGN) of Gram-positive bacteria. It has bactericidal activity towards Gram-positive bacteria. PGLYRP1 / PGLYRP may kill Gram-positive bacteria by interfering with peptidoglycan biosynthesis. It binds also to Gram-negative bacteria, and has bacteriostatic activity towards Gram-negative bacteria.

Peptidoglycan recognition proteins ( PGRPs or PGLYRPs ) are innate immunity proteins that are conserved from insects to mammals, recognize bacterial peptidoglycan, and function in antibacterial immunity and inflammation. Mammals have four PGRPs: PGLYRP1, PGLYRP2, PGLYRP3, and PGLYRP4. They are secreted proteins expressed in polymorphonuclear leukocytes ( PGLYRP1 ), liver ( PGLYRP2 ), or on body surfaces, mucous membranes, and in secretions (saliva, sweat) (PGLYRP3 and PGLYRP4). All PGRPs recognize bacterial peptidoglycan. The PGRPs likely play a role both in antibacterial defenses and several inflammatory diseases. They modulate local inflammatory responses in tissues (such as arthritic joints) and there is evidence for association of PGRPs with inflammatory diseases, such as psoriasis.

Size / Price
Cat No: MG50115-NH
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보2-3 weeks
대량 주문 문의장바구니에 추가
Contact Us
이미지
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".