쥐 Prostasin/PRSS8 Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
     PRSS8 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_133351.2
    cDNA 크기:1020bp
    cDNA 설명:Full length Clone DNA of Mus musculus protease, serine, 8 (prostasin) with N terminal His tag.
    유전자 동의어:CAP1, mCAP1, C79772, AI313909, 2410039E18Rik
    :Mouse
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PRSS8 qPCR primers for gene expression analysis, MP200150 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    연구배경

    Prostasin (Prss8), also known as channel activating protease 1 (CAP1), is a trypsinlike serine peptidase, and plays important roles in epithelial physiology. It is originally purified as an active, soluble enzyme from human seminal fluid and is highly expressed in prostate, lung, kidney, salivary gland and pancreas. Prostasin is expressed as a glycosyl-phosphatidylinositol (GPI)-anchored membrane protein in prostate epithelial cells, and also exists as a secreted proteolytic enzyme possibly via tryptic cleavage of its COOH-terminal hydrophobic domain. Prostasin is found to activate the epithelial sodium channel (ENaC) which is tightly regulated and is critical for maintaining salt and fluid balance in the lung and kidney in both normal and pathological conditions. Accordingly, prostasin has been proposed as a target for therapeutic inhibition in cystic fibrosis. In addition, prostasin inhibits prostate and breast cancer cell invasion in vitro, suggesting a functional role as a suppressor of tumor invasion, as well as a regulator of gene expression during inflammation.

    Size / Price
    Cat No: MG50120-NH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".