쥐 RAC2 Gene ORF cDNA clone expression plasmid, C-Myc 태그

    데이터시트리뷰관련제품프로토콜
     RAC2 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_009008.3
    cDNA 크기:579bp
    cDNA 설명:Full length Clone DNA of Mus musculus RAS-related C3 botulinum substrate 2 with C terminal Myc tag.
    유전자 동의어:AI323801, AI452260
    :Mouse
    벡터:pCMV3-C-Myc
    Plasmid:
    제한 사이트:
    태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    연구배경

    Ras-related C3 botulinum toxin substrate 2 (Rac2) is a small G-protein belonging to the Ras subfamily of the GTPase family. Rac2 acts as an "on / off" switch for signal transduction cascades and motilities. When GDP is attached to the small G-protein, the enzyme is inactivated. Release of the GDP and replace of the GTP cativate the GTPasee. Rac2 remains active until the GTP is hydrolyzed to GDP. Rac2 is a hematopoietic-specific Rho family GTPase implicated as an important constituent of the NADPH oxidase complex and shares 92% amino acid identity with the ubiquitously expressed Rac1. The small G-protein Rac2 regulates the rearrangements of actin and membrane necessary for Fcy receptor-mediated phagocytosis by macrophages. Activated Rac2 binds to the p21-binding domain of PAK1 and this binding provided a basis for microscopic methods to localize activation of these G proteins inside cells.

    참고자료
  • Adam D, et al. (2003) Cdc42, Rac1, and Rac2 Display Distinct Patterns of Activation during Phagocytosis.Mol Biol Cell. 15 (8 ): 3509-19.
  • Walmsley MJ, et al. (2003) Critical Roles for Rac1 and Rac2 GTPases in B Cell Development and Signaling. Science. 302 (5644): 459-62.
  • Holland M, et al. (2011) RAC2, AEP, and ICAM1 expression are associated with CNS disease in a mouse model of pre-B childhood acute lymphoblastic leukemia. Blood. 118 (3): 638-49.
  • Size / Price
    Cat No: MG52761-CM
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".