RIP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51069-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RIP3 Reagents
CRO Services
Product recommended

All RIP3 Reagents
RIP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1461 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse receptor-interacting serine-threonine kinase 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.51kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RIP3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RIP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
Mouse RIPK3 Gene Expression validated Image 14342
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
RIP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2610528K09Rik cDNA ORF Clone, Mouse;AW107945 cDNA ORF Clone, Mouse;Rip3 cDNA ORF Clone, Mouse
RIP3 Background Information
Full Name
receptor-interacting serine-threonine kinase 3

RIP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RIP3 cDNA ORF Clone in Cloning Vector, Mouse MG51069-G
RIP3 cDNA ORF Clone, Mouse, untagged MG51069-UT
RIP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51069-ACG
RIP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51069-ACGLN
RIP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51069-ANG
RIP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51069-ACR
RIP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51069-ANR
RIP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51069-CF
RIP3 cDNA ORF Clone, Mouse, C-His tag MG51069-CH
RIP3 cDNA ORF Clone, Mouse, N-His tag MG51069-NH
RIP3 cDNA ORF Clone, Mouse, C-HA tag MG51069-CY
RIP3 cDNA ORF Clone, Mouse, N-HA tag MG51069-NY
RIP3 cDNA ORF Clone, Mouse, C-Myc tag MG51069-CM
RIP3 cDNA ORF Clone, Mouse, N-Myc tag MG51069-NM
RIP3 qPCR Primer Pairs, Mouse MP201024

RIP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RIP3 cDNA ORF Clone in Cloning Vector, Human HG11267-G
RIP3 cDNA ORF Clone, Human, untagged HG11267-UT
RIP3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11267-ACG
RIP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11267-ACGLN
RIP3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11267-ANG
RIP3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11267-ACR
RIP3 cDNA ORF Clone, Human, N-OFPSpark® tag HG11267-ANR
RIP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11267-CF
RIP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11267-NF
RIP3 cDNA ORF Clone, Human, C-His tag HG11267-CH
RIP3 cDNA ORF Clone, Human, N-His tag HG11267-NH
RIP3 cDNA ORF Clone, Human, C-HA tag HG11267-CY
RIP3 cDNA ORF Clone, Human, N-HA tag HG11267-NY
RIP3 cDNA ORF Clone, Human, C-Myc tag HG11267-CM
RIP3 cDNA ORF Clone, Human, N-Myc tag HG11267-NM
RIP3 qPCR Primer Pairs, Human HP101151
info info
添加购物车成功! 添加购物车失败!