RSPO2 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51078-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RSPO2 Reagents
CRO Services
Product recommended

All RSPO2 Reagents
RSPO2 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
732 bp
Description
Full length Clone DNA of Mouse R-spondin 2 homolog with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RSPO2 cDNA ORF Clone, Mouse, C-His tag Alternative Names
2610028F08Rik cDNA ORF Clone, Mouse;AA673245 cDNA ORF Clone, Mouse;D430027K22 cDNA ORF Clone, Mouse;ftls cDNA ORF Clone, Mouse
RSPO2 Background Information

R-spondin-2, also known as RSPO2, synergizes with Wnt to activate beta-catenin. RSPO2 is secreted proteins that regulate beta-catenin signaling. Activator of the beta-catenin signaling cascade leads to TCF-dependent gene activation. Action both in the canonical Wnt / beta- catenin-dependent pathway, possibly via a direct interaction with Wnt proteins, and in a Wnt-independent beta catenin pathway through a receptor signaling pathway that may not use frizzled / LRP receptors. Probably also acts as a ligand for frizzled and LRP receptors. The encoding gene Rspo2 was identified as a novel common integration site for the mouse mammary tumor virus in viral induced mouse mammary tumors. Rspo2 and Rspo2 / Wnt1 tumors contained many spindle cells, consistent with an epithelial-mesenchymal transformation phenotype. When Rspo2 and Rspo2 / Wnt1 tumor cells were transferred into naive mice, they exhibited greater metastatic activity than cells derived from Wnt1 tumors.

Full Name
R-spondin 2
References
  • Cadieu E, et al. (2009) Coat Variation in the Domestic Dog Is Governed by Variants in Three Genes. Science. 326: 150-153.
  • Kazanskaya O, et al. (2004) R-Spondin2 is a secreted activator of Wnt / beta-catenin signaling and is required for Xenopus myogenesis. Dev Cell. 7(4): 525-34.
  • Parker HG, et al. (2010) An insertion in the RSPO2 gene correlates with improper coat in the Portuguese water dog. J Hered. 101(5):612-7.
  • RSPO2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RSPO2 cDNA ORF Clone in Cloning Vector, Mouse MG51078-G
    RSPO2 cDNA ORF Clone, Mouse, untagged MG51078-UT
    RSPO2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51078-ACG
    RSPO2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51078-ACGLN
    RSPO2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51078-ACR
    RSPO2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51078-CF
    RSPO2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51078-NF
    RSPO2 cDNA ORF Clone, Mouse, N-His tag MG51078-NH
    RSPO2 cDNA ORF Clone, Mouse, C-HA tag MG51078-CY
    RSPO2 cDNA ORF Clone, Mouse, N-HA tag MG51078-NY
    RSPO2 cDNA ORF Clone, Mouse, C-Myc tag MG51078-CM
    RSPO2 cDNA ORF Clone, Mouse, N-Myc tag MG51078-NM
    RSPO2 qPCR Primer Pairs, Mouse MP201036

    RSPO2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RSPO2 cDNA ORF Clone in Cloning Vector, Human HG13084-G
    RSPO2 cDNA ORF Clone, Human, untagged HG13084-UT
    RSPO2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13084-ACGLN
    RSPO2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13084-ACG
    RSPO2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13084-ACR
    RSPO2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13084-CF
    RSPO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13084-NF
    RSPO2 cDNA ORF Clone, Human, C-His tag HG13084-CH
    RSPO2 cDNA ORF Clone, Human, N-His tag HG13084-NH
    RSPO2 cDNA ORF Clone, Human, C-HA tag HG13084-CY
    RSPO2 cDNA ORF Clone, Human, N-HA tag HG13084-NY
    RSPO2 cDNA ORF Clone, Human, C-Myc tag HG13084-CM
    RSPO2 cDNA ORF Clone, Human, N-Myc tag HG13084-NM
    RSPO2 qPCR Primer Pairs, Human HP101701
    info info
    添加购物车成功! 添加购物车失败!