After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 E-Selectin/CD62e/SELE Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Mouse SELE cDNA 클론 제품 정보
Gene_bank_ref_id:NM_011345.2
cDNA 크기:1860bp
cDNA 설명:Full length Clone DNA of Mus musculus selectin, endothelial cell with N terminal His tag.
유전자 동의어:Elam, CD62E, E-selectin, Sele
:Mouse
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

E-selectin, also known as endothelial leukocyte adhesion molecule-1 (ELAM-1) and CD62E, is an inducible adhesion molecule that is expressed on the surfaces of stimulated vascular endothelial cells and is sometimes involved in cancer cell metastasis. E-selectin exhibits a complex mosaic structure consisting of a large extracellular region comprised of a lectin domain, an EGF-like domain, and a short consensus repeat (SCR) domain, followed by a transmembrane region and a relatively short (32 aa) cytoplasmic tail. As a member of the LEC-CAM or selectin family, E-selectin recognises and binds to sialylated carbohydrates including members of the Lewis X and Lewis A families found on monocytes, granulocytes, and T-lymphocytes. E-selectin supports rolling and stable arrest of leukocytes on activated vascular endothelium, and furthermore, it was indicated that it can also transduce an activating stimulus via the MAPK cascade into the endothelial cell during leukocyte adhesion. E-selectin regulates adhesive interactions between certain blood cells and endothelium. The soluble form of E selectin (sE-selectin) is a marker of endothelial activation, and has a potential role in the pathogenesis of cardiovascular disease as raised levels have been found in hypertension, diabetes and hyperlipidemia, although its association in established atherosclerosis disease and its value as a prognostic factor is more controversial. soluble E-selectin is inversely associated with the muscular component of the left ventricle, thereby suggesting that the lack of such a reparative factor may be associated with cardiac remodeling in end-stage renal disease (ESRD) patients. In addition, this adhesion molecule appears to be involved in the pathogenesis of atherosclerosis.

참고자료
  • Roldn V, et al. (2003) Soluble E-selectin in cardiovascular disease and its risk factors. A review of the literature. Thromb Haemost. 90(6): 1007-20.
  • Kawase J, et al. (2009) Increase in E-selectin expression in umbilical vein endothelial cells by anticancer drugs and inhibition by cimetidine. Oncol Rep. 22(6): 1293-7.
  • Matsumoto K, et al. (2010) Soluble adhesion molecule E-selectin predicts cardiovascular events in Japanese patients with type 2 diabetes mellitus. Metabolism. 59(3): 320-4.
  • Stancanelli B, et al. (2010) Soluble e-selectin is an inverse and independent predictor of left ventricular wall thickness in end-stage renal disease patients. Nephron Clin Pract. 114(1): c74-80.
  • Size / Price
    Cat No: MG50736-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".