After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그

데이터시트리뷰관련제품프로토콜
Mouse SEMA4A cDNA 클론 제품 정보
Gene_bank_ref_id:NM_013658.3
cDNA 크기:2283bp
cDNA 설명:Full length Clone DNA of Mus musculus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A, transcript variant 1 with C terminal Myc tag.
유전자 동의어:SemB, Semab, AI132332, Sema4a
:Mouse
벡터:pCMV3-C-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그 on other vectors
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그MG50330-ACG288840
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그MG50330-ACR288840
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그MG50330-CF253470
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그MG50330-CH253470
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그MG50330-CM253470
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그MG50330-CY253470
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone in cloning vectorMG50330-M88420
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그MG50330-NF253470
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그MG50330-NH253470
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그MG50330-NM253470
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그MG50330-NY253470
쥐 Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gene ORF cDNA clone expression plasmidMG50330-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Semaphorin-4A, also known as Semaphorin-B, SEMA4A, Sema B and SEMAB, is a single-pass type I  membrane protein which belongs to the semaphorin family. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. Semaphorin-4A / SEMA4A contains one Ig-like C2-type (immunoglobulin-like) domain, one PSI domain and one Sema domain. Defects in SEMA4A are the cause of retinitis pigmentosa type 35 (RP35) which leads to degeneration of retinal photoreceptor cells. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. Defects in SEMA4A are also the cause of cone-rod dystrophy type 10 (CORD10) which are inherited retinal dystrophies belonging to the group of pigmentary retinopathies. CORDs are characterized by retinal pigment deposits visible on fundus examination, predominantly in the macular region, and initial loss of cone photoreceptors followed by rod degeneration.

Semaphorins are secreted, transmembrane, and GPI-linked proteins, defined by cysteine-rich semaphorin protein domains, that have important roles in a variety of tissues. Humans have 20 semaphorins, Drosophila has five, and two are known from DNA viruses. Semaphorins are found in nematodes and crustaceans but not in non-animals. They are grouped into eight classes on the basis of phylogenetic tree analyses and the presence of additional protein motifs. Semaphorins have been implicated in diverse developmental processes such as axon guidance during nervous system development and regulation of cell migration.

참고자료
  • Clark H.F., et al., 2003, Genome Res. 13: 2265-2270.
  • Ota T., et al., 2004,Nat. Genet. 36: 40-45.
  • Neufeld, G. et al., 2005, Front Biosci. 10 : 751-60.
  • Fiore,R. et al., 2005, Mol Cell Biol. 25 (6):2310-9.
  • Abid A., et al., 2006, J. Med. Genet. 43:378-381.
  • Size / Price
    Cat No: MG50330-CM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".