SERPINB1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50370-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SERPINB1 Reagents
CRO Services
Product recommended

All SERPINB1 Reagents
SERPINB1 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1140 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade B, member 1a with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SERPINB1 Background Information
Full Name
serpin peptidase inhibitor, clade B (ovalbumin), member 1

SERPINB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SERPINB1 cDNA ORF Clone in Cloning Vector, Mouse MG50370-M
SERPINB1 cDNA ORF Clone, Mouse, untagged MG50370-UT
SERPINB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50370-ACGLN
SERPINB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50370-ACG
SERPINB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50370-ANG
SERPINB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50370-ACR
SERPINB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50370-ANR
SERPINB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50370-CF
SERPINB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50370-NF
SERPINB1 cDNA ORF Clone, Mouse, C-His tag MG50370-CH
SERPINB1 cDNA ORF Clone, Mouse, N-His tag MG50370-NH
SERPINB1 cDNA ORF Clone, Mouse, C-HA tag MG50370-CY
SERPINB1 cDNA ORF Clone, Mouse, N-HA tag MG50370-NY
SERPINB1 cDNA ORF Clone, Mouse, N-Myc tag MG50370-NM
SERPINB1 qPCR Primer Pairs, Mouse MP200390

SERPINB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SERPINB1 cDNA ORF Clone in Cloning Vector, Human HG16146-G
SERPINB1 cDNA ORF Clone, Human, untagged HG16146-UT
SERPINB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16146-ACGLN
SERPINB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16146-ACG
SERPINB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16146-ACR
SERPINB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16146-CF
SERPINB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16146-NF
SERPINB1 cDNA ORF Clone, Human, C-His tag HG16146-CH
SERPINB1 cDNA ORF Clone, Human, N-His tag HG16146-NH
SERPINB1 cDNA ORF Clone, Human, C-HA tag HG16146-CY
SERPINB1 cDNA ORF Clone, Human, N-HA tag HG16146-NY
SERPINB1 cDNA ORF Clone, Human, C-Myc tag HG16146-CM
SERPINB1 cDNA ORF Clone, Human, N-Myc tag HG16146-NM
SERPINB1 qPCR Primer Pairs, Human HP104915
info info
添加购物车成功! 添加购物车失败!