쥐 SerpinD1 Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
     SERPIND1 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_008223.3
    cDNA 크기:1437bp
    cDNA 설명:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade D, member 1 with N terminal His tag.
    유전자 동의어:HCII, Hcf2, AA985900, AI303446, MGC107662
    :Mouse
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SerpinD1 qPCR primers for gene expression analysis, MP200151 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    연구배경

    SerpinD1, also known as heparin cofactor II (HCâ…¡), is a member of Serpin superfamily of the serine proteinase inhibitors. HCII is a glycoprotein in human plasma that inhibits thrombin and chymotrypsin, and the rate of inhibition of thrombin is rapidly increased by Dermatan sulfate (DS), heparin (H) and glycosaminoglycans(GAG). The stimulatory effect of glycosaminoglycans on the inhibition is mediated, in part, by the N-terminal acidic domain of HCII. Interestingly, a C-terminal His-tagged recombinant HCII exhibits enhanced activity of thrombin inhibition. It has been suggested that HCII plays an unique and important role in vascular homeostasis, and accordingly mutations in this gene or congenital HCII deficiency is potentially associated with thrombosis. HCII specifically inhibits thrombin action at the site of vascular wall injury and HCII-thrombin complexes have been detected in human plasma. HCII protects against thrombin-induced vascular remodeling in both humans and mice and suggest that HCII is a predictive biomarker and therapeutic target for atherosclerosis. SerpinD1 also inhibits chymotrypsin, but in a glycosaminoglycan-independent manner.

    참고자료
  • Rau JC, et al. (2009) Heparin cofactor II in atherosclerotic lesions from the Pathobiological Determinants of Atherosclerosis in Youth (PDAY) study. Exp Mol Pathol. 87(3): 178-83.
  • Aihara K, et al. (2009) Heparin cofactor II as a novel vascular protective factor against atherosclerosis. J Atheroscler Thromb. 16(5): 523-31.
  • Size / Price
    Cat No: MG50121-NH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".