쥐 SIGIRR/TIR8 Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
     SIGIRR cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_023059.3
    cDNA 크기:1230bp
    cDNA 설명:Full length Clone DNA of Mus musculus single immunoglobulin and toll-interleukin 1 receptor (TIR) domain with N terminal His tag.
    유전자 동의어:TIR8, AI256711, MGC102426
    :Mouse
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SIGIRR qPCR primers for gene expression analysis, MP200152 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    연구배경

    Single Ig IL-1-related receptor (SIGIRR) or TIR8 is a member of Toll-like receptor-interleukin 1 receptor signaling (TLR-IL-1R) receptor superfamily. Although SIGIRR/TIR8 shows the typical conserved motifs that characterize the IL-1R and Toll superfamily, it is structurally and functionally distinct from both. SIGIRR/TIR8 has only one Ig domain in its extracellular portion whereas the IL-1R family contains three Ig folds. An unusually long cytoplasmic domain is reminiscent of the structure of drosophila Toll, yet the SIGIRR peptide sequence is more closely related to IL-1RI. SIGIRR/TIR8 was mainly expressed in mouse and human epithelial tissues such as kidney, lung and gut. Resting and activated T and B lymphocytes and monocytes-macrophages expressed little or no SIGIRR/TIR8, with the exception of the mouse GG2EE macrophage line. Inflammation is enhanced in SIGIRR-deficient mice. SIGIRR negatively modulates immune responses. Inflammation is enhanced in SIGIRR-deficient mice, as shown by their enhanced chemokine induction after IL-1 injection and reduced threshold for lethal endotoxin challenge.

    참고자료
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Polentarutti N, et al. (2003) Unique pattern of expression and inhibition of IL-1 signaling by the IL-1 receptor family member TIR8/SIGIRR. Eur Cytokine Netw. 14(4): 211-8.
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Size / Price
    Cat No: MG50122-NH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".