SLC25A5 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51406-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLC25A5 Reagents
CRO Services
Product recommended

All SLC25A5 Reagents
SLC25A5 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Mouse solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 5 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A5 cDNA ORF Clone, Mouse, N-His tag Alternative Names
Ant2 cDNA ORF Clone, Mouse
SLC25A5 Background Information
Full Name
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5

SLC25A5 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SLC25A5 cDNA ORF Clone in Cloning Vector, Rhesus CG90815-G
SLC25A5 cDNA ORF Clone, Rhesus, untagged CG90815-UT
SLC25A5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90815-ACGLN
SLC25A5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90815-ACG
SLC25A5 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90815-ANG
SLC25A5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90815-ACR
SLC25A5 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90815-ANR
SLC25A5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90815-CF
SLC25A5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90815-NF
SLC25A5 cDNA ORF Clone, Rhesus, C-His tag CG90815-CH
SLC25A5 cDNA ORF Clone, Rhesus, N-His tag CG90815-NH
SLC25A5 cDNA ORF Clone, Rhesus, C-HA tag CG90815-CY
SLC25A5 cDNA ORF Clone, Rhesus, N-HA tag CG90815-NY
SLC25A5 cDNA ORF Clone, Rhesus, C-Myc tag CG90815-CM
SLC25A5 cDNA ORF Clone, Rhesus, N-Myc tag CG90815-NM

SLC25A5 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
SLC25A5 cDNA ORF Clone in Cloning Vector, Rabbit TG65133-G
SLC25A5 cDNA ORF Clone, Rabbit, untagged TG65133-UT
SLC25A5 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65133-ACG
SLC25A5 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65133-ANG
SLC25A5 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65133-ACR
SLC25A5 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65133-ANR
SLC25A5 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65133-CF
SLC25A5 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65133-NF
SLC25A5 cDNA ORF Clone, Rabbit, C-His tag TG65133-CH
SLC25A5 cDNA ORF Clone, Rabbit, N-His tag TG65133-NH
SLC25A5 cDNA ORF Clone, Rabbit, C-HA tag TG65133-CY
SLC25A5 cDNA ORF Clone, Rabbit, N-HA tag TG65133-NY
SLC25A5 cDNA ORF Clone, Rabbit, C-Myc tag TG65133-CM
SLC25A5 cDNA ORF Clone, Rabbit, N-Myc tag TG65133-NM

SLC25A5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLC25A5 cDNA ORF Clone in Cloning Vector, Rat RG81484-G

SLC25A5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A5 cDNA ORF Clone in Cloning Vector, Mouse MG51406-G
SLC25A5 cDNA ORF Clone, Mouse, untagged MG51406-UT
SLC25A5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51406-ACGLN
SLC25A5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51406-ACG
SLC25A5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51406-ANG
SLC25A5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51406-ACR
SLC25A5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51406-ANR
SLC25A5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51406-CF
SLC25A5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51406-NF
SLC25A5 cDNA ORF Clone, Mouse, C-His tag MG51406-CH
SLC25A5 cDNA ORF Clone, Mouse, C-HA tag MG51406-CY
SLC25A5 cDNA ORF Clone, Mouse, N-HA tag MG51406-NY
SLC25A5 cDNA ORF Clone, Mouse, C-Myc tag MG51406-CM
SLC25A5 cDNA ORF Clone, Mouse, N-Myc tag MG51406-NM
SLC25A5 qPCR Primer Pairs, Mouse MP201290

SLC25A5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A5 cDNA ORF Clone in Cloning Vector, Human HG16208-G
SLC25A5 cDNA ORF Clone, Human, untagged HG16208-UT
SLC25A5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16208-ACGLN
SLC25A5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16208-ACG
SLC25A5 cDNA ORF Clone, Human, N-GFPSpark® tag HG16208-ANG
SLC25A5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16208-ACR
SLC25A5 cDNA ORF Clone, Human, N-OFPSpark® tag HG16208-ANR
SLC25A5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16208-CF
SLC25A5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16208-NF
SLC25A5 cDNA ORF Clone, Human, C-His tag HG16208-CH
SLC25A5 cDNA ORF Clone, Human, N-His tag HG16208-NH
SLC25A5 cDNA ORF Clone, Human, C-HA tag HG16208-CY
SLC25A5 cDNA ORF Clone, Human, N-HA tag HG16208-NY
SLC25A5 cDNA ORF Clone, Human, C-Myc tag HG16208-CM
SLC25A5 cDNA ORF Clone, Human, N-Myc tag HG16208-NM
SLC25A5 qPCR Primer Pairs, Human HP104974
info info
添加购物车成功! 添加购物车失败!